Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BetI - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Osmotic stress response
Effector: Betaine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155 5 1
Shewanella denitrificans OS217 4 1
Shewanella frigidimarina NCIMB 400 5 1
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345 5 1
Shewanella halifaxensis HAW-EB4 5 1
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3 6 2
Shewanella woodyi ATCC 51908 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
betT2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1945: Predicted choline transporter BetT-II, BCCT family
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -360
score = 6.99699
sequence = TTAATTGATCGTTCAATTAA

Gene: Ssed_1773: Predicted choline transporter BetT-II, BCCT family
 
Shewanella woodyi ATCC 51908
Predicted choline transporter BetT-II, BCCT family
 
CRON 2.
betI
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -63
score = 6.98037
sequence = TGGATTGAACGTTCAATTAA

Gene: Sbal_1323: glycine betaine biosynthesis transcriptional regulator, TetR family
*
Shewanella denitrificans OS217

Site:
position = -46
score = 7.50991
sequence = TTAATTGAACGTTCAATTAA

Gene: Sden_0713: glycine betaine biosynthesis transcriptional regulator, TetR family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -51
score = 7.19124
sequence = TTAATTGAGCGTTCAATTAA

Gene: Sfri_1948: glycine betaine biosynthesis transcriptional regulator, TetR family
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -97
score = 7.29903
sequence = TTAATTGAACGTTCAATCAA

Gene: Spea_1009: glycine betaine biosynthesis transcriptional regulator, TetR family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -96
score = 7.29903
sequence = TTAATTGAACGTTCAATCAA

Gene: Shal_1059: glycine betaine biosynthesis transcriptional regulator, TetR family
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -73
score = 7.50991
sequence = TTAATTGAACGTTCAATTAA

Gene: Ssed_1121: glycine betaine biosynthesis transcriptional regulator, TetR family
*
Shewanella woodyi ATCC 51908

Site:
position = -83
score = 7.50991
sequence = TTAATTGAACGTTCAATTAA

Gene: Swoo_1198: glycine betaine biosynthesis transcriptional regulator, TetR family
glycine betaine biosynthesis transcriptional regulator, TetR family
betB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_1324: Betaine aldehyde dehydrogenase (EC 1.2.1.8)
 
Shewanella denitrificans OS217

Gene: Sden_0714: Betaine aldehyde dehydrogenase (EC 1.2.1.8)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1947: Betaine aldehyde dehydrogenase (EC 1.2.1.8)
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_1008: Betaine aldehyde dehydrogenase (EC 1.2.1.8)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1058: Betaine aldehyde dehydrogenase (EC 1.2.1.8)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1120: Betaine aldehyde dehydrogenase (EC 1.2.1.8)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1197: Betaine aldehyde dehydrogenase (EC 1.2.1.8)
Betaine aldehyde dehydrogenase (EC 1.2.1.8)
betA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_1325: Choline dehydrogenase (EC 1.1.99.1)
 
Shewanella denitrificans OS217

Gene: Sden_0715: Choline dehydrogenase (EC 1.1.99.1)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1946: Choline dehydrogenase (EC 1.1.99.1)
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_1007: Choline dehydrogenase (EC 1.1.99.1)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1057: Choline dehydrogenase (EC 1.1.99.1)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1119: Choline dehydrogenase (EC 1.1.99.1)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1196: Choline dehydrogenase (EC 1.1.99.1)
Choline dehydrogenase (EC 1.1.99.1)
betT
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_1326: Predicted choline transporter BetT, BCCT family
 
Shewanella denitrificans OS217

Gene: Sden_0716: Predicted choline transporter BetT, BCCT family
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1945: Predicted choline transporter BetT, BCCT family
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_1006: Predicted choline transporter BetT, BCCT family
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1056: Predicted choline transporter BetT, BCCT family
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1118: Predicted choline transporter BetT, BCCT family
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1195: Predicted choline transporter BetT, BCCT family
Predicted choline transporter BetT, BCCT family
Sbal_1327
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_1327: Conserved hypothetical protein 2001
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1944: Conserved hypothetical protein 2001
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_1005: Conserved hypothetical protein 2001
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1055: Conserved hypothetical protein 2001
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1117: Conserved hypothetical protein 2001
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1194: Conserved hypothetical protein 2001
Conserved hypothetical protein 2001
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD