Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Bpro_5109 - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666 3 1
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2 9 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Bpro_5109
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -80
score = 5.70558
sequence = ACGTGAATACGTATTCACAG

Site:
position = -26
score = 6.04472
sequence = TTATGACTACGTATTCAAAA

Gene: Bpro_5109: Predicted transcriptional regulator, LacI family
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
*
Verminephrobacter eiseniae EF01-2

Site:
position = -34
score = 5.78684
sequence = AAATGACTACGAATACATTT

Gene: Veis_4515: Predicted transcriptional regulator, LacI family
Predicted transcriptional regulator, LacI family
Veis_4516
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4516: Predicted sugar ABC transporter, substrate-binding protein
Predicted sugar ABC transporter, substrate-binding protein
Veis_4517
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4517: Predicted sugar ABC transporter, permease protein 1
Predicted sugar ABC transporter, permease protein 1
Veis_4518
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4518: Predicted sugar ABC transporter, permease protein 2
Predicted sugar ABC transporter, permease protein 2
Veis_4519
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4519: Predicted oxidoreductase
Predicted oxidoreductase
Veis_4520
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4520: Predicted dehydrogenase
Predicted dehydrogenase
Veis_4521
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4521: Predicted sugar ABC transporter, ATP-binding protein
Predicted sugar ABC transporter, ATP-binding protein
Veis_4522
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_5110: Putative membrane protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4522: Putative membrane protein
Putative membrane protein
Veis_4523
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1

Gene: Mpe_A3651: Putative dehydratase
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_5111: Putative dehydratase
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3211: Putative dehydratase
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4523: Putative dehydratase
Putative dehydratase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD