Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Csal_3216 - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cellvibrio japonicus Ueda107
Teredinibacter turnerae T7901
Saccharophagus degradans 2-40
Marinobacter aqueolei
Marinobacter sp. ELB17
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043 7 2
Hahella chejuensis KCTC 2396
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Csal_3216
 
Cellvibrio japonicus Ueda107
 
Teredinibacter turnerae T7901
 
Saccharophagus degradans 2-40
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Alcanivorax borkumensis SK2
*
Chromohalobacter salexigens DSM 3043

Site:
position = -120
score = 7.29043
sequence = TTTTGGTAGCGCTACCAAAA

Site:
position = -78
score = 6.77048
sequence = TATTGGTAGCGCTACCAGAT

Gene: Csal_3216: Predicted transcriptional regulator, LacI family
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted transcriptional regulator, LacI family
Csal_3217
 
Cellvibrio japonicus Ueda107
 
Teredinibacter turnerae T7901
 
Saccharophagus degradans 2-40
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_3217: Hypothetical protein
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Hypothetical protein
 
CRON 2.
Csal_3215
 
Cellvibrio japonicus Ueda107
 
Teredinibacter turnerae T7901
 
Saccharophagus degradans 2-40
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Alcanivorax borkumensis SK2
*
Chromohalobacter salexigens DSM 3043

Site:
position = -126
score = 6.77048
sequence = ATCTGGTAGCGCTACCAATA

Site:
position = -84
score = 7.29043
sequence = TTTTGGTAGCGCTACCAAAA

Gene: Csal_3215: Predicted sugar carboxylase
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted sugar carboxylase
Csal_3214
 
Cellvibrio japonicus Ueda107
 
Teredinibacter turnerae T7901
 
Saccharophagus degradans 2-40
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_16323: TRAP transporterm, DctP subunit
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_3214: TRAP transporterm, DctP subunit
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
TRAP transporterm, DctP subunit
Csal_3213
 
Cellvibrio japonicus Ueda107
 
Teredinibacter turnerae T7901
 
Saccharophagus degradans 2-40
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_16318: TRAP transporter, DctQ system
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_3213: TRAP transporter, DctQ system
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
TRAP transporter, DctQ system
Csal_3212
 
Cellvibrio japonicus Ueda107
 
Teredinibacter turnerae T7901
 
Saccharophagus degradans 2-40
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_16313: TRAP transporter, DctM subunit
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_3212: TRAP transporter, DctM subunit
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
TRAP transporter, DctM subunit
Csal_3211
 
Cellvibrio japonicus Ueda107
 
Teredinibacter turnerae T7901
 
Saccharophagus degradans 2-40
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_3211: Predicted NAD-dependent sugar epimerase/dehydratase
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted NAD-dependent sugar epimerase/dehydratase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD