Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannose utilization
Effector: Mannose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Aeromonas hydrophila subsp. hydrophila ATCC 7966 8 3
Aeromonas salmonicida subsp. salmonicida A449
Psychromonas sp. CNPT3
Psychromonas ingrahamii 37
Moritella sp. PE36
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
manA1
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -182
score = 6.5146
sequence = AAGGTATATCGATTAACCTT

Site:
position = -50
score = 6.28689
sequence = CAGGTTAATCGATTTATCTC

Gene: AHA_2343: Mannose-6-phosphate isomerase, class I
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Mannose-6-phosphate isomerase, class I
manW
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2342: Mannose-specific PTS, IIA component (EC 2.7.1.69)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Mannose-specific PTS, IIA component (EC 2.7.1.69)
manX
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2341: Mannose-specific PTS, IIB component (EC 2.7.1.69)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Mannose-specific PTS, IIB component (EC 2.7.1.69)
manY
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2340: Mannose-specific PTS, IIC component (EC 2.7.1.69)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Mannose-specific PTS, IIC component (EC 2.7.1.69)
manZ
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2339: Mannose-specific PTS, IID component (EC 2.7.1.69)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Mannose-specific PTS, IID component (EC 2.7.1.69)
manA
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2338: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
CRON 2.
manR
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -191
score = 6.28689
sequence = GAGATAAATCGATTAACCTG

Site:
position = -59
score = 6.5146
sequence = AAGGTTAATCGATATACCTT

Gene: AHA_2344: Mannose utilization transcriptional regulator ManR, LacI family
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Mannose utilization transcriptional regulator ManR, LacI family
 
CRON 3.
pgiA
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -83
score = 5.74651
sequence = GTGGTTAATGGATTAACCCT

Gene: AHA_2345: Glucose-6-phosphate isomerase, archaeal (EC 5.3.1.9)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
 
Moritella sp. PE36
 
Tolumonas auensis DSM 9187
Glucose-6-phosphate isomerase, archaeal (EC 5.3.1.9)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD