Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AzrR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 3 2
Shewanella putrefaciens CN-32 3 2
Shewanella sp W3-18-1 3 2
Shewanella sp ANA-3 3 2
Shewanella sp MR-4 3 2
Shewanella sp MR-7 3 2
Shewanella baltica OS155 3 2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B 4 2
Shewanella loihica PV-4 3 2
Shewanella pealeana ATCC 700345 3 2
Shewanella halifaxensis HAW-EB4 3 2
Shewanella piezotolerans WP3 3 2
Shewanella sediminis HAW-EB3 4 2
Shewanella woodyi ATCC 51908 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
azr
*
Shewanella oneidensis MR-1

Site:
position = -62
score = 6.47589
sequence = CTTTACAAGATTAAATAAAG

Gene: SO_3585: NADPH-dependent FMN reductase
*
Shewanella putrefaciens CN-32

Site:
position = -62
score = 6.47589
sequence = CTTTACAAGATTAAATAAAG

Site:
position = -100
score = 5.13942
sequence = CTTTAACAGATTAAATAAAC

Gene: Sputcn32_1017: NADPH-dependent FMN reductase
*
Shewanella sp W3-18-1

Site:
position = -62
score = 6.47589
sequence = CTTTACAAGATTAAATAAAG

Site:
position = -100
score = 5.13942
sequence = CTTTAACAGATTAAATAAAC

Gene: Sputw3181_3148: NADPH-dependent FMN reductase
*
Shewanella sp ANA-3

Site:
position = -62
score = 6.47589
sequence = CTTTACAAGATTAAATAAAG

Gene: Shewana3_3177: NADPH-dependent FMN reductase
*
Shewanella sp MR-4

Site:
position = -62
score = 6.47589
sequence = CTTTACAAGATTAAATAAAG

Gene: Shewmr4_2999: NADPH-dependent FMN reductase
*
Shewanella sp MR-7

Site:
position = -62
score = 6.47589
sequence = CTTTACAAGATTAAATAAAG

Gene: Shewmr7_3080: NADPH-dependent FMN reductase
*
Shewanella baltica OS155

Site:
position = -62
score = 6.47589
sequence = CTTTACAAGATTAAATAAAG

Site:
position = -100
score = 5.44781
sequence = CTTTAATAGATTAAATAAAC

Gene: Sbal_1010: NADPH-dependent FMN reductase
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -77
score = 6.65198
sequence = CTTTACATAATTAAGTAAAG

Gene: Sama_2787: NADPH-dependent FMN reductase
*
Shewanella loihica PV-4

Site:
position = -63
score = 6.56807
sequence = CTTTACAAAATTAAATAAAG

Gene: Shew_0914: NADPH-dependent FMN reductase
*
Shewanella pealeana ATCC 700345

Site:
position = -65
score = 5.61701
sequence = CTTTACTTTGTTTGGTAAAG

Gene: Spea_0887: NADPH-dependent FMN reductase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -65
score = 5.35516
sequence = CTTTACTTTGTTTTGTAAGG

Gene: Shal_0939: NADPH-dependent FMN reductase
*
Shewanella piezotolerans WP3

Site:
position = -64
score = 6.31833
sequence = CTTTACTTTATTATGTAAAG

Gene: swp_0891: NADPH-dependent FMN reductase
*
Shewanella sediminis HAW-EB3

Site:
position = -64
score = 6.31833
sequence = CTTTACAACATTTAGTAAAG

Gene: Ssed_0994: NADPH-dependent FMN reductase
*
Shewanella woodyi ATCC 51908

Site:
position = -63
score = 5.91111
sequence = CTTTACATTACTTAGTAAAG

Gene: Swoo_1047: NADPH-dependent FMN reductase
NADPH-dependent FMN reductase
Sden_0935
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2788: Glyoxalase/dioxygenase superfamily protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0993: Glyoxalase/dioxygenase superfamily protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1046: Glyoxalase/dioxygenase superfamily protein
Glyoxalase/dioxygenase superfamily protein
SO3586
 
Shewanella oneidensis MR-1

Gene: SO_3586: Glyoxalase family protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1016: Glyoxalase family protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_3149: Glyoxalase family protein
 
Shewanella sp ANA-3

Gene: Shewana3_3178: Glyoxalase family protein
 
Shewanella sp MR-4

Gene: Shewmr4_3000: Glyoxalase family protein
 
Shewanella sp MR-7

Gene: Shewmr7_3081: Glyoxalase family protein
 
Shewanella baltica OS155

Gene: Sbal_1009: Glyoxalase family protein
 
Shewanella denitrificans OS217

Gene: Sden_2124: Glyoxalase family protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1566: Glyoxalase family protein
 
Shewanella amazonensis SB2B

Gene: Sama_2789: Glyoxalase family protein
 
Shewanella loihica PV-4

Gene: Shew_0913: Glyoxalase family protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0886: Glyoxalase family protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0938: Glyoxalase family protein
 
Shewanella piezotolerans WP3

Gene: swp_0890: Glyoxalase family protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0992: Glyoxalase family protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1045: Glyoxalase family protein
Glyoxalase family protein
 
CRON 2.
azrR
*
Shewanella oneidensis MR-1

Site:
position = -104
score = 6.47589
sequence = CTTTATTTAATCTTGTAAAG

Gene: SO_3584: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella putrefaciens CN-32

Site:
position = -66
score = 5.13942
sequence = GTTTATTTAATCTGTTAAAG

Site:
position = -104
score = 6.47589
sequence = CTTTATTTAATCTTGTAAAG

Gene: Sputcn32_1018: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella sp W3-18-1

Site:
position = -66
score = 5.13942
sequence = GTTTATTTAATCTGTTAAAG

Site:
position = -104
score = 6.47589
sequence = CTTTATTTAATCTTGTAAAG

Gene: Sputw3181_3147: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella sp ANA-3

Site:
position = -104
score = 6.47589
sequence = CTTTATTTAATCTTGTAAAG

Gene: Shewana3_3176: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella sp MR-4

Site:
position = -104
score = 6.47589
sequence = CTTTATTTAATCTTGTAAAG

Gene: Shewmr4_2998: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella sp MR-7

Site:
position = -104
score = 6.47589
sequence = CTTTATTTAATCTTGTAAAG

Gene: Shewmr7_3079: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella baltica OS155

Site:
position = -67
score = 5.44781
sequence = GTTTATTTAATCTATTAAAG

Site:
position = -105
score = 6.47589
sequence = CTTTATTTAATCTTGTAAAG

Gene: Sbal_1011: putative transcriptional regulator of azoreductase, AsnC family
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -106
score = 6.65198
sequence = CTTTACTTAATTATGTAAAG

Gene: Sama_2786: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella loihica PV-4

Site:
position = -97
score = 6.56807
sequence = CTTTATTTAATTTTGTAAAG

Gene: Shew_0915: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella pealeana ATCC 700345

Site:
position = -104
score = 5.61701
sequence = CTTTACCAAACAAAGTAAAG

Gene: Spea_0888: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -92
score = 5.35516
sequence = CCTTACAAAACAAAGTAAAG

Gene: Shal_0940: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella piezotolerans WP3

Site:
position = -80
score = 6.31833
sequence = CTTTACATAATAAAGTAAAG

Gene: swp_0892: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella sediminis HAW-EB3

Site:
position = -99
score = 6.31833
sequence = CTTTACTAAATGTTGTAAAG

Gene: Ssed_0995: putative transcriptional regulator of azoreductase, AsnC family
*
Shewanella woodyi ATCC 51908

Site:
position = -104
score = 5.91111
sequence = CTTTACTAAGTAATGTAAAG

Gene: Swoo_1048: putative transcriptional regulator of azoreductase, AsnC family
putative transcriptional regulator of azoreductase, AsnC family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD