Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR1 - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alteromonadales bacterium TW-7 1 1
Alteromonas macleodii 'Deep ecotype'
Colwellia psychrerythraea 34H 7 3
Glaciecola sp. HTCC2999
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Pseudoalteromonas atlantica T6c
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mnnA1
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
*2
Colwellia psychrerythraea 34H

Gene: CPS_2650: Alpha-1,2-mannosidase

Site:
position = -40
score = 6.84481
sequence = TAATTGGAACGTTCCAAAAA

Gene: CPS_2651: Alpha-1,2-mannosidase
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 3
Pseudoalteromonas atlantica T6c

Gene: Patl_0117: Alpha-1,2-mannosidase

Gene: Patl_0116: Alpha-1,2-mannosidase

Gene: Patl_0120: Alpha-1,2-mannosidase
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -31
score = 6.01358
sequence = TGCTTGGAACGATCCAATTA

Gene: PTD2_02161: Alpha-1,2-mannosidase
Alpha-1,2-mannosidase
manP1
*
Alteromonadales bacterium TW-7

Site:
position = -87
score = 6.23068
sequence = AATTTGGAACGTTCTAATTA

Gene: ATW7_00410: Predicted mannose transporter, GGP family
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_2649: Predicted mannose transporter, GGP family
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0119: Predicted mannose transporter, GGP family
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02166: Predicted mannose transporter, GGP family
Predicted mannose transporter, GGP family
manK
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_2648: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
manI
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01636: D-mannose isomerase (EC 5.3.1.7)
 
Colwellia psychrerythraea 34H

Gene: CPS_2647: D-mannose isomerase (EC 5.3.1.7)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0118: D-mannose isomerase (EC 5.3.1.7)
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -69
score = 6.03678
sequence = TTATTGGAGCGTTCCAAAAG

Gene: PTD2_02171: D-mannose isomerase (EC 5.3.1.7)
D-mannose isomerase (EC 5.3.1.7)
 
CRON 2.
manR1
 
Alteromonadales bacterium TW-7

Gene: ATW7_02272: Transcriptional regulator of mannoside utilization, LacI family
 
Alteromonas macleodii 'Deep ecotype'
*
Colwellia psychrerythraea 34H

Site:
position = -102
score = 6.84481
sequence = TTTTTGGAACGTTCCAATTA

Gene: CPS_2652: Transcriptional regulator of mannoside utilization, LacI family
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03216: Transcriptional regulator of mannoside utilization, LacI family
Transcriptional regulator of mannoside utilization, LacI family
 
CRON 3.
omp(Man)
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
*
Colwellia psychrerythraea 34H

Site:
position = -152
score = 6.38637
sequence = GCATTGGAACGTTCCAATTA

Site:
position = -64
score = 5.52903
sequence = ATAACGGAACGTTCCACTTA

Gene: CPS_2653: Mannosides-regulated TonB-dependent outer membrane receptor
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0122: Mannosides-regulated TonB-dependent outer membrane receptor
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0165: Mannosides-regulated TonB-dependent outer membrane receptor
 
Pseudoalteromonas tunicata D2

Gene: PTD2_22047: Mannosides-regulated TonB-dependent outer membrane receptor
Mannosides-regulated TonB-dependent outer membrane receptor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD