Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR2 - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 8 3
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2
Alteromonadales bacterium TW-7
Alteromonas macleodii 'Deep ecotype'
Colwellia psychrerythraea 34H
Glaciecola sp. HTCC2999
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
manR2
*
Pseudoalteromonas atlantica T6c

Site:
position = -144
score = 6.04161
sequence = TTTTGTTATCGATTACAGTA

Site:
position = -239
score = 6.74508
sequence = AATTGTAATCGATTACAATT

Gene: Patl_0121: Transcriptional regulator of mannoside utilization, variant 2, LacI family
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Transcriptional regulator of mannoside utilization, variant 2, LacI family
 
CRON 2.
mnnA1
*3
Pseudoalteromonas atlantica T6c

Gene: Patl_0117: Alpha-1,2-mannosidase

Gene: Patl_0116: Alpha-1,2-mannosidase

Site:
position = -133
score = 6.74508
sequence = AATTGTAATCGATTACAATT

Site:
position = -228
score = 6.04161
sequence = TACTGTAATCGATAACAAAA

Gene: Patl_0120: Alpha-1,2-mannosidase
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02161: Alpha-1,2-mannosidase
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 2
Colwellia psychrerythraea 34H

Gene: CPS_2651: Alpha-1,2-mannosidase

Gene: CPS_2650: Alpha-1,2-mannosidase
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Alpha-1,2-mannosidase
manP
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0119: Predicted mannose transporter, GGP family
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02166: Predicted mannose transporter, GGP family
 
Alteromonadales bacterium TW-7

Gene: ATW7_00410: Predicted mannose transporter, GGP family
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_2649: Predicted mannose transporter, GGP family
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Predicted mannose transporter, GGP family
manI
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0118: D-mannose isomerase (EC 5.3.1.7)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02171: D-mannose isomerase (EC 5.3.1.7)
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01636: D-mannose isomerase (EC 5.3.1.7)
 
Colwellia psychrerythraea 34H

Gene: CPS_2647: D-mannose isomerase (EC 5.3.1.7)
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
D-mannose isomerase (EC 5.3.1.7)
 
CRON 3.
omp(Man)
*
Pseudoalteromonas atlantica T6c

Site:
position = -165
score = 6.78347
sequence = AATTGTAATCGATTACATTT

Gene: Patl_0122: Mannosides-regulated TonB-dependent outer membrane receptor
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0165: Mannosides-regulated TonB-dependent outer membrane receptor
 
Pseudoalteromonas tunicata D2

Gene: PTD2_22047: Mannosides-regulated TonB-dependent outer membrane receptor
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H

Gene: CPS_2653: Mannosides-regulated TonB-dependent outer membrane receptor
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Mannosides-regulated TonB-dependent outer membrane receptor
mnnA2
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0123: Alpha-1,2-mannosidase
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Alpha-1,2-mannosidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD