Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Enterococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Enterococcus faecalis V583 9 1
Enterococcus faecium DO
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglB
*
Enterococcus faecalis V583

Site:
position = -39
score = 6.83644
sequence = TTGTAGAAACGTTTCACTAA

Site:
position = -217
score = 6.83644
sequence = TTGGTGAAACGTTTCTATAA

Gene: EF1232: Predicted beta-glucoside ABC transport system, permease protein 1
 
Enterococcus faecium DO
Predicted beta-glucoside ABC transport system, permease protein 1
bglC
 
Enterococcus faecalis V583

Gene: EF1233: Predicted beta-glucoside ABC transport system, permease protein 2
 
Enterococcus faecium DO
Predicted beta-glucoside ABC transport system, permease protein 2
bglA
 
Enterococcus faecalis V583

Gene: EF1234: Predicted beta-glucoside ABC transport system, sugar-binding protein
 
Enterococcus faecium DO
Predicted beta-glucoside ABC transport system, sugar-binding protein
EF1235
 
Enterococcus faecalis V583

Gene: EF1235: Hypothetical protein
 
Enterococcus faecium DO
Hypothetical protein
EF1236
 
Enterococcus faecalis V583

Gene: EF1236: Putative acetyl xylan esterase
 
Enterococcus faecium DO
Putative acetyl xylan esterase
EF1237
 
Enterococcus faecalis V583

Gene: EF1237: Conserved hypothetical protein
 
Enterococcus faecium DO
Conserved hypothetical protein
bglX
 
Enterococcus faecalis V583

Gene: EF1238: Beta-glucosidase (EC 3.2.1.21)
 
Enterococcus faecium DO
Beta-glucosidase (EC 3.2.1.21)
cbpA
 
Enterococcus faecalis V583

Gene: EF1239: Cellobiose phosphorylase (EC 2.4.1.-)
 
Enterococcus faecium DO
Cellobiose phosphorylase (EC 2.4.1.-)
bglR
 
Enterococcus faecalis V583

Gene: EF1240: Transcriptional regulator for beta-glucoside utilization, LacI family
 
Enterococcus faecium DO
Transcriptional regulator for beta-glucoside utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD