Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EF1410 - Enterococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Enterococcus faecalis V583 2 2
Enterococcus faecium DO
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
EF1411
*
Enterococcus faecalis V583

Site:
position = -42
score = 6.52087
sequence = AGATGTAAACGATAACAATT

Gene: EF1411: Predicted glycosyl hydrolase, family 4
 
Enterococcus faecium DO
Predicted glycosyl hydrolase, family 4
 
CRON 2.
EF1410
*
Enterococcus faecalis V583

Site:
position = -119
score = 6.52087
sequence = AATTGTTATCGTTTACATCT

Gene: EF1410: Predicted transcriptional regulator, LacI family
 
Enterococcus faecium DO
Predicted transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD