Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ABC1167 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16 3 1
Bacillus halodurans C-125
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ABC1168
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -35
score = 6.78073
sequence = TTTTGAATACGTATGCAAGA

Site:
position = -71
score = 6.73701
sequence = CATTGCATACGTATGCAAAT

Gene: ABC1168: Putative dehydrogenase
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative dehydrogenase
ABC1167
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC1167: Predicted transcriptional regulator, LacI family
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted transcriptional regulator, LacI family
gntT
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC1166: Gluconate transporter
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Gluconate transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD