Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IolR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cellvibrio japonicus Ueda107
Marinobacter aqueolei
Marinobacter sp. ELB17
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043
Hahella chejuensis KCTC 2396 7 1
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iolV
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
*
Hahella chejuensis KCTC 2396

Site:
position = -76
score = 6.12174
sequence = TTTTGCACACGGGTGCAATG

Gene: HCH_03296: Predicted inositol ABC transporter, substrate-binding protein
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted inositol ABC transporter, substrate-binding protein
iolW
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396

Gene: HCH_03297: Predicted inositol ABC transporter, permease protein 1
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted inositol ABC transporter, permease protein 1
iolX
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396

Gene: HCH_03298: Predicted inositol ABC transporter, permease protein 2
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted inositol ABC transporter, permease protein 2
iolY
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396

Gene: HCH_03299: Predicted inositol ABC transporter, ATP-binding protein
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2713: Predicted inositol ABC transporter, ATP-binding protein
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted inositol ABC transporter, ATP-binding protein
iolZ
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396

Gene: HCH_03300: Predicted metal-dependent hydrolase
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0184: Predicted metal-dependent hydrolase
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Predicted metal-dependent hydrolase
suhB
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396

Gene: HCH_03301: Inositol-1-monophosphatase (EC 3.1.3.25)
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Inositol-1-monophosphatase (EC 3.1.3.25)
iolR
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396

Gene: HCH_03302: Inositol utilization transcriptional regulator IolR, LacI family
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
Inositol utilization transcriptional regulator IolR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD