Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CcpB - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 2 1
Listeria monocytogenes EGD-e 2 1
Listeria seeligeri serovar 1/2b str. SLCC3954 2 1
Listeria welshimeri serovar 6b str. SLCC5334 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lmo2738
*
Listeria innocua Clip11262

Site:
position = -47
score = 6.59898
sequence = GAAATTGTCCGGAATATTTT

Gene: lin2881: Conserved hypothetical protein
*
Listeria monocytogenes EGD-e

Site:
position = -72
score = 6.70997
sequence = CAAATTGTCCGGAATATTTA

Gene: lmo2738: Conserved hypothetical protein
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -72
score = 6.8081
sequence = AAAATTGTCCGGAATATTTA

Gene: lse_2651: Conserved hypothetical protein
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -72
score = 6.91909
sequence = TAAATTGTCCGGAATATTTA

Gene: lwe2686: Conserved hypothetical protein
Conserved hypothetical protein
ccpB
 
Listeria innocua Clip11262

Gene: lin2880: Predicted transcriptional regulator CcpB, LacI family
 
Listeria monocytogenes EGD-e

Gene: lmo2737: Predicted transcriptional regulator CcpB, LacI family
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2650: Predicted transcriptional regulator CcpB, LacI family
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2685: Predicted transcriptional regulator CcpB, LacI family
Predicted transcriptional regulator CcpB, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD