Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR1 - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895
Edwardsiella tarda EIB202
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568 6 2
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnR1
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
*
Serratia proteamaculans 568

Site:
position = -162
score = 6.14112
sequence = TGGCTGGACTAGTCCAGCAA

Gene: Spro_4489: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Yersinia pestis KIM
2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
CRON 2.
phnS
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
*
Serratia proteamaculans 568

Site:
position = -49
score = 6.14112
sequence = TTGCTGGACTAGTCCAGCCA

Gene: Spro_4488: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Yersinia pestis KIM
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Spro_4487
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4487: type I phosphodiesterase
 
Yersinia pestis KIM
type I phosphodiesterase
phnU
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4486: A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Yersinia pestis KIM
A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnV
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4485: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Yersinia pestis KIM
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnT
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4484: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Yersinia pestis KIM
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD