Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 3 2
Acidovorax sp. JS42 6 4
Comamonas testosteroni KF-1 2 1
Delftia acidovorans SPH-1 3 2
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1 8 5
Polaromonas naphthalenivorans CJ2 3 2
Polaromonas sp. JS666 6 4
Rhodoferax ferrireducens DSM 15236 2 2
Variovorax paradoxus S110 4 3
Verminephrobacter eiseniae EF01-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copA2
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -64
score = 5.33325
sequence = ACCTTCCCACGATGGTAAGCC

Gene: Ajs_1372: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4495: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Delftia acidovorans SPH-1

Site:
position = -58
score = 4.877
sequence = ACCTTGACATGGTGGCAATCT

Gene: Daci_5724: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR3
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_1373: Copper-responsive transcriptional regulator, MerR family
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Copper-responsive transcriptional regulator, MerR family
 
CRON 2.
Mpe_A1644
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
*
Methylibium petroleiphilum PM1

Site:
position = -81
score = 5.25854
sequence = ACCTTCCCACGTTGTCAAGGT

Gene: Mpe_A1644: hypothetical protein
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
hypothetical protein
copA3
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1777: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1645: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Copper-translocating P-type ATPase (EC 3.6.3.4)
 
CRON 3.
copZ2
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -65
score = 5.12475
sequence = ACCTTCCCACCGTGACAAGGC

Gene: Ajs_1368: Copper chaperone
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1834: Copper chaperone
*2
Methylibium petroleiphilum PM1

Site:
position = -57
score = 5.24
sequence = ACCTTCCAACAGTAGGAGGGT

Gene: Mpe_A1641: Copper chaperone

Site:
position = -61
score = 5.46484
sequence = ACCTTCCCACCGGGGCAACGT

Gene: Mpe_A3536: Copper chaperone
*
Polaromonas naphthalenivorans CJ2

Site:
position = -67
score = 5.48205
sequence = ACTTTGCCACCGTGGGAAGGT

Gene: Pnap_4089: Copper chaperone
*2
Polaromonas sp. JS666

Site:
position = -218
score = 5.61164
sequence = ACCCTGCCCCCGTGGGAAGGT

Gene: Bpro_4871: Copper chaperone

Site:
position = -26
score = 5.01024
sequence = ACCTTCCCACAGTCGGAAGCA

Gene: Bpro_3497: Copper chaperone
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Copper chaperone
 
CRON 4.
copZ
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -110
score = 4.8873
sequence = CCCCTGACATCATGGCAAGGT

Gene: Aave_0033: Copper chaperone
*
Acidovorax sp. JS42

Site:
position = -140
score = 5.03886
sequence = ACCCTGACATGCTGGCAAGGT

Gene: Ajs_0018: Copper chaperone
*
Comamonas testosteroni KF-1

Site:
position = -80
score = 4.94241
sequence = ACCTTGTCATGATGTTAGGGT

Gene: CtesDRAFT_3915: Copper chaperone
*
Delftia acidovorans SPH-1

Site:
position = -77
score = 5.3267
sequence = ACCTTGCCATGGTGTCAGGGT

Gene: Daci_0035: Copper chaperone
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -70
score = 4.94434
sequence = ACATTGACATCATGAGAAGGT

Gene: Vapar_0030: Copper chaperone
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_1021: Copper chaperone
Copper chaperone
cueR
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0032: Copper resistance ranscriptional regulator, MerR family
 
Acidovorax sp. JS42

Gene: Ajs_0017: Copper resistance ranscriptional regulator, MerR family
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_3914: Copper resistance ranscriptional regulator, MerR family
 
Delftia acidovorans SPH-1

Gene: Daci_0034: Copper resistance ranscriptional regulator, MerR family
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
*
Rhodoferax ferrireducens DSM 15236

Site:
position = 12
score = 6.01477
sequence = ACCTTCCCACGGTGGCAAGGT

Gene: Rfer_0023: Copper resistance ranscriptional regulator, MerR family
 
Variovorax paradoxus S110

Gene: Vapar_0029: Copper resistance ranscriptional regulator, MerR family
 
Verminephrobacter eiseniae EF01-2
Copper resistance ranscriptional regulator, MerR family
 
CRON 5.
copA
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -34
score = 4.8873
sequence = ACCTTGCCATGATGTCAGGGG

Gene: Aave_0034: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Acidovorax sp. JS42

Site:
position = -58
score = 5.03886
sequence = ACCTTGCCAGCATGTCAGGGT

Gene: Ajs_0019: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1835: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Methylibium petroleiphilum PM1

Site:
position = -34
score = 5.65196
sequence = ACTTTGCCATGATGGGAAGGT

Gene: Mpe_A3535: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -59
score = 4.80881
sequence = ACCTTGCCATCGTTAGAACCT

Gene: Mpe_A1640: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -82
score = 5.69883
sequence = ACCCTGCCATGATGGCAAGGT

Gene: Pnap_4090: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Polaromonas sp. JS666

Site:
position = -84
score = 5.65003
sequence = ACCCTGCCATGATGGTAAGGT

Gene: Bpro_4872: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -72
score = 5.37456
sequence = ACTTTCCAACAGTGGCAAGGT

Gene: Bpro_3496: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -35
score = 5.81361
sequence = ACCTTGCCATGATGGGAAGGA

Gene: Rfer_0024: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Variovorax paradoxus S110

Site:
position = -34
score = 4.78556
sequence = ACCTTGCCATGATGTGAGACT

Gene: Vapar_0031: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_1058: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR2
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 2
Methylibium petroleiphilum PM1

Gene: Mpe_A3534: Copper-responsive transcriptional regulator, MerR family

Gene: Mpe_A1639: Copper-responsive transcriptional regulator, MerR family
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_4091: Copper-responsive transcriptional regulator, MerR family
 2
Polaromonas sp. JS666

Gene: Bpro_4873: Copper-responsive transcriptional regulator, MerR family

Gene: Bpro_3495: Copper-responsive transcriptional regulator, MerR family
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -60
score = 4.63388
sequence = ACTCTCCCATGGTGTGAAGGC

Gene: Vapar_2999: Copper-responsive transcriptional regulator, MerR family
 
Verminephrobacter eiseniae EF01-2
Copper-responsive transcriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD