Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Jk1423 - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor (activator)
Biological process:
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975 3 1
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314
Corynebacterium glutamicum ATCC 13032
Corynebacterium jeikeium K411 3 1
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
jk1421
 
Corynebacterium amycolatum SK46
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -100
score = 6.17126
sequence = TTAGAAACATAGTGTTGCCAT

Site:
position = -78
score = 6.00158
sequence = ATAGAAACAGAATGTTTCTAT

Gene: cauri_1677: Predicted ABC transporter, permease protein
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
*
Corynebacterium jeikeium K411

Site:
position = -82
score = 5.97138
sequence = TTGGCAACACATCGTTGCTAA

Site:
position = -104
score = 5.97138
sequence = TTAGAAACACCCTGTTTTTAT

Gene: jk1421: Predicted ABC transporter, permease protein
 
Corynebacterium kroppenstedtii DSM 44385
*
Corynebacterium urealyticum DSM 7109

Site:
position = -104
score = 6.39613
sequence = TTGGCAACACGGTGTTGCTAA

Site:
position = -126
score = 5.60593
sequence = TTGGCAACGCCTTGTTTTCAT

Gene: cur_0150: Predicted ABC transporter, permease protein
Predicted ABC transporter, permease protein
jk1422
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1678: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0490: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk1422: Predicted ABC transporter, ATP-binding protein
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0149: Predicted ABC transporter, ATP-binding protein
Predicted ABC transporter, ATP-binding protein
jk1423
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1679: Predicted transcriptional regulator, TetR family
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE0491: Predicted transcriptional regulator, TetR family
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk1423: Predicted transcriptional regulator, TetR family
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0148: Predicted transcriptional regulator, TetR family
Predicted transcriptional regulator, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD