Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Cg2314 - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314
Corynebacterium glutamicum ATCC 13032 3 2
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cg2313
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -51
score = 6.40613
sequence = CTACTAGAACGTTATAGTAG

Gene: cg2313: Predicted sugar dehydrogenase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted sugar dehydrogenase
cg2312
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2312: Predicted sugar isomerase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted sugar isomerase
 
CRON 2.
cg2314
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -95
score = 6.40613
sequence = CTACTATAACGTTCTAGTAG

Gene: cg2314: Predicted transcription regulator, LacI family
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted transcription regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD