Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NikR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: NikR
Regulation mode: repressor
Biological process: Nickel homeostasis
Effector: Nickel ion, (Ni2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345 7 3
Shewanella halifaxensis HAW-EB4 7 3
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3 6 2
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omp_Ni
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -96
score = 7.13013
sequence = GTAATACTTTTTTAAAATTCGTCATAC

Gene: Spea_1138: Predicted outer membrane nickel transporter, TonB-dependent family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -138
score = 7.13013
sequence = GTAATACTTTTTTAAAATTCGTCATAC

Gene: Shal_1183: Predicted outer membrane nickel transporter, TonB-dependent family
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1673: Predicted outer membrane nickel transporter, TonB-dependent family
 
Shewanella woodyi ATCC 51908
Predicted outer membrane nickel transporter, TonB-dependent family
 
CRON 2.
nikR
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -164
score = 7.10802
sequence = GTAATACTATTTTTAGAATCGTCACAC

Gene: Spea_3645: Nickel responsive regulator NikR, CopG family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -164
score = 6.82165
sequence = GTAATACTATTTTTCGAATCGTCACAC

Gene: Shal_3729: Nickel responsive regulator NikR, CopG family
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -167
score = 7.03082
sequence = GTAATACTACTTTTAGATTCGTAATAC

Gene: Ssed_1674: Nickel responsive regulator NikR, CopG family
 
Shewanella woodyi ATCC 51908
Nickel responsive regulator NikR, CopG family
 
CRON 3.
nikA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -49
score = 7.10802
sequence = GTGTGACGATTCTAAAAATAGTATTAC

Gene: Spea_3644: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -49
score = 6.82165
sequence = GTGTGACGATTCGAAAAATAGTATTAC

Gene: Shal_3728: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -56
score = 7.03082
sequence = GTATTACGAATCTAAAAGTAGTATTAC

Gene: Ssed_1675: Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
 
Shewanella woodyi ATCC 51908
Nickel ABC transporter, periplasmic nickel-binding protein nikA2 (TC 3.A.1.5.3)
nikB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3643: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3727: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1676: Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
 
Shewanella woodyi ATCC 51908
Nickel transport system permease protein nikB2 (TC 3.A.1.5.3)
nikC
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3642: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3726: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1677: Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
 
Shewanella woodyi ATCC 51908
Nickel transport system permease protein nikC2 (TC 3.A.1.5.3)
nikD
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3641: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3725: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1678: Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
 
Shewanella woodyi ATCC 51908
Nickel transport system ATP-binding protein nikD2 (TC 3.A.1.5.2)
nikE
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_3640: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3724: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1679: Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
 
Shewanella woodyi ATCC 51908
Nickel transport system ATP-binding protein nikE2 (TC 3.A.1.5.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD