Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 192 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 16 10
Shewanella putrefaciens CN-32 14 9
Shewanella sp W3-18-1 16 10
Shewanella sp ANA-3 17 10
Shewanella sp MR-4 14 9
Shewanella sp MR-7 17 11
Shewanella baltica OS155 18 11
Shewanella denitrificans OS217 15 10
Shewanella frigidimarina NCIMB 400 14 9
Shewanella amazonensis SB2B 18 11
Shewanella loihica PV-4 17 10
Shewanella pealeana ATCC 700345 15 10
Shewanella halifaxensis HAW-EB4 18 12
Shewanella piezotolerans WP3 12 8
Shewanella sediminis HAW-EB3 14 9
Shewanella woodyi ATCC 51908 15 10
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
umuD
*
Shewanella oneidensis MR-1

Site:
position = -32
score = 5.63726
sequence = AACTGTATATTTATACAGTT

Gene: SO_A0013: DNA polymerase V, subunit UmuD
*
Shewanella putrefaciens CN-32

Site:
position = -32
score = 5.44547
sequence = AACTGTATATTTGTACAGTT

Gene: Sputcn32_0175: DNA polymerase V, subunit UmuD
*
Shewanella sp W3-18-1

Site:
position = -46
score = 5.856
sequence = TACTGTATAAACAAACAGTA

Gene: Sputw3181_1083: DNA polymerase V, subunit UmuD
*2
Shewanella sp ANA-3

Site:
position = -23
score = 5.86662
sequence = TACTGTATTAATGTACAGTA

Gene: Shewana3_4173: DNA polymerase V, subunit UmuD

Site:
position = 14
score = 6.03457
sequence = TACTGTATTTACATACAGTA

Gene: Shewana3_1833: DNA polymerase V, subunit UmuD
*
Shewanella sp MR-4

Site:
position = 14
score = 6.03306
sequence = TACTGTACTTATATACAGTA

Gene: Shewmr4_1782: DNA polymerase V, subunit UmuD
*
Shewanella sp MR-7

Site:
position = 14
score = 6.22485
sequence = TACTGTATTTATATACAGTA

Gene: Shewmr7_2195: DNA polymerase V, subunit UmuD
*2
Shewanella baltica OS155

Site:
position = -30
score = 5.64231
sequence = TGCTGTATATAATTACAGTG

Gene: Sbal_3554: DNA polymerase V, subunit UmuD

Site:
position = -34
score = 5.63885
sequence = TACTGTTCATACGTACAGTA

Gene: Sbal_2352: DNA polymerase V, subunit UmuD
*
Shewanella denitrificans OS217

Site:
position = -29
score = 5.9556
sequence = TACTGTATATAATTACAGTG

Gene: Sden_3236: DNA polymerase V, subunit UmuD
*2
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3452: DNA polymerase V, subunit UmuD

Site:
position = -58
score = 5.91351
sequence = TACTGTTTATTTATACAGTG

Site:
position = -43
score = 4.80666
sequence = CAGTGTGTTTTTATACAGTA

Gene: Sfri_1963: DNA polymerase V, subunit UmuD
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -34
score = 5.69919
sequence = TACTGTATAAACATACAGTT

Gene: Spea_2196: DNA polymerase V, subunit UmuD
*2
Shewanella halifaxensis HAW-EB4

Site:
position = -34
score = 5.92564
sequence = TACTGTATAAAAATACAGTG

Gene: Shal_2184: DNA polymerase V, subunit UmuD

Site:
position = -35
score = 5.69768
sequence = TACTGTACAAATATACAGTT

Gene: Shal_2170: DNA polymerase V, subunit UmuD
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -39
score = 6.14168
sequence = TACTGTATATTTATACAGTA

Gene: Ssed_2172: DNA polymerase V, subunit UmuD
*
Shewanella woodyi ATCC 51908

Site:
position = -38
score = 5.29774
sequence = TACTGTATAAAAACACAGTT

Gene: Swoo_2465: DNA polymerase V, subunit UmuD
DNA polymerase V, subunit UmuD
umuC
 
Shewanella oneidensis MR-1

Gene: SO_A0012: DNA polymerase V, subunit UmuC
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1

Gene: Sputw3181_1082: DNA polymerase V, subunit UmuC
 2
Shewanella sp ANA-3

Gene: Shewana3_4172: DNA polymerase V, subunit UmuC

Gene: Shewana3_1832: DNA polymerase V, subunit UmuC
 2
Shewanella sp MR-4

Gene: Shewmr4_3210: DNA polymerase V, subunit UmuC

Gene: Shewmr4_2120: DNA polymerase V, subunit UmuC
 
Shewanella sp MR-7

Gene: Shewmr7_2196: DNA polymerase V, subunit UmuC
 2
Shewanella baltica OS155

Gene: Sbal_3553: DNA polymerase V, subunit UmuC

Gene: Sbal_2353: DNA polymerase V, subunit UmuC
 
Shewanella denitrificans OS217

Gene: Sden_3235: DNA polymerase V, subunit UmuC
 2
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3453: DNA polymerase V, subunit UmuC

Gene: Sfri_1964: DNA polymerase V, subunit UmuC
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345

Gene: Spea_2195: DNA polymerase V, subunit UmuC
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_2183: DNA polymerase V, subunit UmuC

Gene: Shal_2169: DNA polymerase V, subunit UmuC
 
Shewanella piezotolerans WP3

Gene: swp_4680: DNA polymerase V, subunit UmuC
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2171: DNA polymerase V, subunit UmuC
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2466: DNA polymerase V, subunit UmuC
DNA polymerase V, subunit UmuC
 
CRON 2.
xerD
*
Shewanella oneidensis MR-1

Site:
position = -39
score = 5.47588
sequence = TACTGTATAAAATTACAGCG

Gene: SO_2037: Site-specific recombinase XerD
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
*
Shewanella sp MR-7

Site:
position = -39
score = 5.40829
sequence = TACTGTATAAAACAACAGTA

Gene: Shewmr7_2132: Site-specific recombinase XerD
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*2
Shewanella amazonensis SB2B

Site:
position = -38
score = 5.87725
sequence = TACTGTTTTTATATACAGTT

Gene: Sama_1355: Site-specific recombinase XerD

Site:
position = -34
score = 5.35077
sequence = CACTGTACGTACATACAGTT

Gene: Sama_1633: Site-specific recombinase XerD
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -48
score = 5.83024
sequence = CACTGTTTTTTTATACAGTA

Gene: Swoo_4307: Site-specific recombinase XerD
Site-specific recombinase XerD
 
CRON 3.
yebG
*
Shewanella oneidensis MR-1

Site:
position = -31
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: SO_2604: SOS regulon DNA damage-inducible protein
*
Shewanella putrefaciens CN-32

Site:
position = -30
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: Sputcn32_2205: SOS regulon DNA damage-inducible protein
*
Shewanella sp W3-18-1

Site:
position = -30
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: Sputw3181_1804: SOS regulon DNA damage-inducible protein
*
Shewanella sp ANA-3

Site:
position = -31
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: Shewana3_1775: SOS regulon DNA damage-inducible protein
*
Shewanella sp MR-4

Site:
position = -31
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: Shewmr4_1670: SOS regulon DNA damage-inducible protein
*
Shewanella sp MR-7

Site:
position = -31
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: Shewmr7_1745: SOS regulon DNA damage-inducible protein
*
Shewanella baltica OS155

Site:
position = -31
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: Sbal_2450: SOS regulon DNA damage-inducible protein
*
Shewanella denitrificans OS217

Site:
position = -31
score = 5.99668
sequence = CACTGTATATAAAAACAGTA

Gene: Sden_1719: SOS regulon DNA damage-inducible protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -31
score = 5.8639
sequence = CACTGTATATAAAAACAGTG

Gene: Sfri_2231: SOS regulon DNA damage-inducible protein
*
Shewanella amazonensis SB2B

Site:
position = -31
score = 5.78073
sequence = CACTGTATAAATAAACAGTG

Gene: Sama_1582: SOS regulon DNA damage-inducible protein
*
Shewanella loihica PV-4

Site:
position = -31
score = 5.74447
sequence = AACTGTATATAAAAACAGTG

Gene: Shew_1799: SOS regulon DNA damage-inducible protein
*
Shewanella pealeana ATCC 700345

Site:
position = -31
score = 5.8639
sequence = CACTGTATATAAAAACAGTG

Gene: Spea_1932: SOS regulon DNA damage-inducible protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -31
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: Shal_2367: SOS regulon DNA damage-inducible protein
*
Shewanella piezotolerans WP3

Site:
position = 11
score = 5.99668
sequence = TACTGTATATAAAAACAGTG

Gene: swp_2821: SOS regulon DNA damage-inducible protein
*
Shewanella sediminis HAW-EB3

Site:
position = -31
score = 5.87725
sequence = AACTGTATATAAAAACAGTA

Gene: Ssed_2486: SOS regulon DNA damage-inducible protein
*
Shewanella woodyi ATCC 51908

Site:
position = -31
score = 5.87725
sequence = AACTGTATATAAAAACAGTA

Gene: Swoo_2130: SOS regulon DNA damage-inducible protein
SOS regulon DNA damage-inducible protein
yebR
 
Shewanella oneidensis MR-1

Gene: SO_2603: COG1956, GAF domain-containing protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2204: COG1956, GAF domain-containing protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1805: COG1956, GAF domain-containing protein
 
Shewanella sp ANA-3

Gene: Shewana3_1776: COG1956, GAF domain-containing protein
 
Shewanella sp MR-4

Gene: Shewmr4_1671: COG1956, GAF domain-containing protein
 
Shewanella sp MR-7

Gene: Shewmr7_1746: COG1956, GAF domain-containing protein
 
Shewanella baltica OS155

Gene: Sbal_2449: COG1956, GAF domain-containing protein
 
Shewanella denitrificans OS217

Gene: Sden_1720: COG1956, GAF domain-containing protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2230: COG1956, GAF domain-containing protein
 
Shewanella amazonensis SB2B

Gene: Sama_1583: COG1956, GAF domain-containing protein
 
Shewanella loihica PV-4

Gene: Shew_1800: COG1956, GAF domain-containing protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_1933: COG1956, GAF domain-containing protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2366: COG1956, GAF domain-containing protein
 
Shewanella piezotolerans WP3

Gene: swp_2820: COG1956, GAF domain-containing protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2485: COG1956, GAF domain-containing protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2131: COG1956, GAF domain-containing protein
COG1956, GAF domain-containing protein
 
CRON 4.
dinB
*
Shewanella oneidensis MR-1

Site:
position = -44
score = 5.87725
sequence = AACTGTTTTTATATACAGTA

Gene: SO_1114: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella putrefaciens CN-32

Site:
position = 20
score = 5.74501
sequence = TACTGGTTTTATATACAGTA

Gene: Sputcn32_0951: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella sp W3-18-1

Site:
position = -43
score = 5.74501
sequence = TACTGGTTTTATATACAGTA

Gene: Sputw3181_3225: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella sp ANA-3

Site:
position = -44
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Shewana3_0949: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella sp MR-4

Site:
position = -44
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Shewmr4_0947: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella sp MR-7

Site:
position = -44
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Shewmr7_0985: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella baltica OS155

Site:
position = -43
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Sbal_0935: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella denitrificans OS217

Site:
position = -52
score = 5.83024
sequence = CACTGTTTTTTTATACAGTA

Gene: Sden_1185: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -57
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Sfri_0961: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella amazonensis SB2B

Site:
position = -36
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Sama_2527: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella loihica PV-4

Site:
position = -43
score = 5.85449
sequence = TACTGTTTAAATGTACAGTA

Gene: Shew_2871: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella pealeana ATCC 700345

Site:
position = -44
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Spea_3092: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -44
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: Shal_3176: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella piezotolerans WP3

Site:
position = -95
score = 6.12946
sequence = TACTGTTTTTATATACAGTA

Gene: swp_1179: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella sediminis HAW-EB3

Site:
position = -56
score = 6.04628
sequence = TACTGTTTAAATATACAGTA

Gene: Ssed_3422: DNA polymerase IV (EC 2.7.7.7)
*
Shewanella woodyi ATCC 51908

Site:
position = -52
score = 5.99668
sequence = CACTGTTTTTATATACAGTA

Gene: Swoo_3604: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
 
CRON 5.
recN
*
Shewanella oneidensis MR-1

Site:
position = -72
score = 5.76698
sequence = TACTGTATATAAAATCAGTA

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: SO_3462: DNA repair protein RecN
*
Shewanella putrefaciens CN-32

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Site:
position = -72
score = 5.76698
sequence = TACTGTATATAAAATCAGTA

Gene: Sputcn32_2771: DNA repair protein RecN
*
Shewanella sp W3-18-1

Site:
position = -72
score = 5.76698
sequence = TACTGTATATAAAATCAGTA

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: Sputw3181_1241: DNA repair protein RecN
*
Shewanella sp ANA-3

Site:
position = -72
score = 5.86238
sequence = TACTGTATATAAATTCAGTA

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: Shewana3_1104: DNA repair protein RecN
*
Shewanella sp MR-4

Site:
position = -72
score = 5.86238
sequence = TACTGTATATAAATTCAGTA

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: Shewmr4_1104: DNA repair protein RecN
*
Shewanella sp MR-7

Site:
position = -72
score = 5.86238
sequence = TACTGTATATAAATTCAGTA

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: Shewmr7_1170: DNA repair protein RecN
*
Shewanella baltica OS155

Site:
position = -72
score = 5.76698
sequence = TACTGTATATAAAATCAGTA

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: Sbal_3153: DNA repair protein RecN
*
Shewanella denitrificans OS217

Site:
position = -71
score = 5.44579
sequence = TACTGTATAAAAAACCAGTG

Site:
position = -49
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: Sden_1151: DNA repair protein RecN
*
Shewanella frigidimarina NCIMB 400

Site:
position = -50
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Site:
position = -72
score = 5.76698
sequence = TACTGTATATAAAATCAGTA

Gene: Sfri_1043: DNA repair protein RecN
*
Shewanella amazonensis SB2B

Site:
position = -73
score = 5.40875
sequence = TACTGTACAAAAAATCAGTA

Site:
position = -51
score = 5.2956
sequence = TACTGTGTATCAATACAGTA

Gene: Sama_1026: DNA repair protein RecN
*
Shewanella loihica PV-4

Site:
position = -62
score = 5.69594
sequence = TACTGTATAAAAATTCAGTA

Site:
position = -40
score = 4.94534
sequence = TACTGTGCATGAATACAGTA

Gene: Shew_1196: DNA repair protein RecN
*
Shewanella pealeana ATCC 700345

Site:
position = -40
score = 5.30243
sequence = TACTGTTTAACCATACAGTG

Site:
position = -62
score = 5.856
sequence = TACTGTATGAATAAACAGTA

Gene: Spea_1169: DNA repair protein RecN
*
Shewanella halifaxensis HAW-EB4

Site:
position = -62
score = 5.79193
sequence = TACTGTATAGATAAACAGTA

Site:
position = -40
score = 5.49272
sequence = TACTGTTTAACTATACAGTG

Gene: Shal_1212: DNA repair protein RecN
*
Shewanella piezotolerans WP3

Site:
position = -61
score = 5.70867
sequence = TACTGTATAGAAAAACAGTA

Site:
position = -39
score = 5.57589
sequence = TACTGTTTATCAATACAGTG

Gene: swp_1346: DNA repair protein RecN
*
Shewanella sediminis HAW-EB3

Site:
position = -40
score = 5.45456
sequence = TACTGTTTAAAAACACAGTA

Site:
position = -62
score = 5.76698
sequence = TACTGTATATAAAATCAGTA

Gene: Ssed_1281: DNA repair protein RecN
*
Shewanella woodyi ATCC 51908

Site:
position = -64
score = 5.93766
sequence = TACTGTATTTATGAACAGTA

Site:
position = -42
score = 5.93766
sequence = TACTGTTCATAAATACAGTA

Gene: Swoo_3359: DNA repair protein RecN
DNA repair protein RecN
 
CRON 6.
lexA
*
Shewanella oneidensis MR-1

Site:
position = -45
score = 5.88597
sequence = TACTGTATATACTAACAGTA

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Gene: SO_4603: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella putrefaciens CN-32

Site:
position = -45
score = 5.88597
sequence = TACTGTATATACTAACAGTA

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Gene: Sputcn32_3780: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella sp W3-18-1

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Site:
position = -45
score = 5.88597
sequence = TACTGTATATACTAACAGTA

Gene: Sputw3181_0135: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella sp ANA-3

Site:
position = -45
score = 5.88597
sequence = TACTGTATATACTAACAGTA

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Gene: Shewana3_3989: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella sp MR-4

Site:
position = -45
score = 5.88597
sequence = TACTGTATATACTAACAGTA

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Gene: Shewmr4_3789: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella sp MR-7

Site:
position = -45
score = 5.88597
sequence = TACTGTATATACTAACAGTA

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Gene: Shewmr7_3862: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella baltica OS155

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Site:
position = -45
score = 5.88597
sequence = TACTGTATATACTAACAGTA

Gene: Sbal_0156: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella denitrificans OS217

Site:
position = -45
score = 5.14443
sequence = TACTGTATATAATGACAGTC

Site:
position = -26
score = 5.10565
sequence = CACTGTATAAAAAGACAGGA

Gene: Sden_3515: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -45
score = 5.01165
sequence = CACTGTATATAATGACAGTC

Site:
position = -26
score = 5.10565
sequence = CACTGTATAAAAAGACAGGA

Gene: Sfri_0260: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella amazonensis SB2B

Site:
position = -45
score = 5.5987
sequence = TACTGTATATACTGACAGTA

Site:
position = -26
score = 5.01913
sequence = AACTGTATAGAAAAACAGGA

Gene: Sama_3481: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella loihica PV-4

Site:
position = -45
score = 4.90916
sequence = TACTGTATATACTGACAGGT

Site:
position = -26
score = 4.79379
sequence = TACTGTATGGAAAGACAGGA

Gene: Shew_0127: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella pealeana ATCC 700345

Site:
position = -45
score = 5.19643
sequence = TACTGTATATACTAACAGGT

Site:
position = -26
score = 4.85129
sequence = TACTGTATAGAAAGACAGGG

Gene: Spea_3997: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -45
score = 4.90916
sequence = TACTGTATATACTGACAGGT

Site:
position = -26
score = 4.85129
sequence = TACTGTATAGAAAGACAGGG

Gene: Shal_0260: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella piezotolerans WP3

Site:
position = -45
score = 5.19643
sequence = TACTGTATATACTAACAGGT

Site:
position = -26
score = 5.01913
sequence = TACTGTATAGAAAAACAGGT

Gene: swp_4821: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella sediminis HAW-EB3

Site:
position = -45
score = 5.63376
sequence = TACTGTATATACTAACAGTT

Site:
position = -26
score = 4.98407
sequence = TACTGTATAGAAAGACAGGA

Gene: Ssed_0200: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Shewanella woodyi ATCC 51908

Site:
position = -26
score = 4.98407
sequence = TACTGTATAGAAAGACAGGA

Site:
position = -45
score = 5.34649
sequence = TACTGTATATACTGACAGTT

Gene: Swoo_0180: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
sulA
 
Shewanella oneidensis MR-1

Gene: SO_4604: Cell division inhibitor sulA
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3781: Cell division inhibitor sulA
 
Shewanella sp W3-18-1

Gene: Sputw3181_0134: Cell division inhibitor sulA
 
Shewanella sp ANA-3

Gene: Shewana3_3990: Cell division inhibitor sulA
 
Shewanella sp MR-4

Gene: Shewmr4_3790: Cell division inhibitor sulA
 
Shewanella sp MR-7

Gene: Shewmr7_3863: Cell division inhibitor sulA
 
Shewanella baltica OS155

Gene: Sbal_0155: Cell division inhibitor sulA
 
Shewanella denitrificans OS217

Gene: Sden_3516: Cell division inhibitor sulA
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0259: Cell division inhibitor sulA
 
Shewanella amazonensis SB2B

Gene: Sama_3482: Cell division inhibitor sulA
 
Shewanella loihica PV-4

Gene: Shew_0126: Cell division inhibitor sulA
 
Shewanella pealeana ATCC 700345

Gene: Spea_3998: Cell division inhibitor sulA
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0259: Cell division inhibitor sulA
 
Shewanella piezotolerans WP3

Gene: swp_4822: Cell division inhibitor sulA
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0199: Cell division inhibitor sulA
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0179: Cell division inhibitor sulA
Cell division inhibitor sulA
 
CRON 7.
topB
*
Shewanella oneidensis MR-1

Site:
position = -32
score = 5.70393
sequence = TACTGTAATTATATCCAGTA

Gene: SO_3061: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella putrefaciens CN-32

Site:
position = -32
score = 5.57115
sequence = TACTGTAATTATATCCAGTG

Gene: Sputcn32_2435: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella sp W3-18-1

Site:
position = -32
score = 5.57115
sequence = TACTGTAATTATATCCAGTG

Gene: Sputw3181_1573: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella sp ANA-3

Site:
position = -32
score = 5.43837
sequence = CACTGTAATTATATCCAGTG

Gene: Shewana3_1486: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella sp MR-4

Site:
position = -32
score = 5.57115
sequence = CACTGTAATTATATCCAGTA

Gene: Shewmr4_1433: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella sp MR-7

Site:
position = 30
score = 5.57115
sequence = CACTGTAATTATATCCAGTA

Gene: Shewmr7_1498: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella baltica OS155

Site:
position = -32
score = 5.57115
sequence = TACTGTAATTATATCCAGTG

Gene: Sbal_2736: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella denitrificans OS217

Site:
position = -41
score = 5.63254
sequence = CACTGTAATTACATACAGTG

Gene: Sden_2400: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -67
score = 5.753
sequence = TACTGTAAATTTATACAGTT

Gene: Sfri_1401: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella amazonensis SB2B

Site:
position = 29
score = 5.29769
sequence = TACTGTAAATTCATCCAGTG

Gene: Sama_2145: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella loihica PV-4

Site:
position = -32
score = 5.90981
sequence = TACTGTTAATTTATACAGTA

Gene: Shew_2299: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella pealeana ATCC 700345

Site:
position = -36
score = 5.90981
sequence = TACTGTTAATTTATACAGTA

Gene: Spea_1625: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -36
score = 5.90981
sequence = TACTGTTAATTTATACAGTA

Gene: Shal_2636: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella piezotolerans WP3

Site:
position = -36
score = 5.77703
sequence = TACTGTTAATTTATACAGTG

Gene: swp_3111: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella sediminis HAW-EB3

Site:
position = -38
score = 5.39258
sequence = TACTGGTAATTTATACAGTG

Gene: Ssed_1658: DNA topoisomerase III (EC 5.99.1.2)
*
Shewanella woodyi ATCC 51908

Site:
position = -35
score = 5.39258
sequence = TACTGGTAATTTATACAGTG

Gene: Swoo_2976: DNA topoisomerase III (EC 5.99.1.2)
DNA topoisomerase III (EC 5.99.1.2)
 
CRON 8.
recA
*
Shewanella oneidensis MR-1

Site:
position = -127
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: SO_3430: Recombinase A
*
Shewanella putrefaciens CN-32

Site:
position = -129
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Sputcn32_2747: Recombinase A
*
Shewanella sp W3-18-1

Site:
position = -129
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Sputw3181_1265: Recombinase A
*
Shewanella sp ANA-3

Site:
position = -128
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Shewana3_1126: Recombinase A
*
Shewanella sp MR-4

Site:
position = -128
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Shewmr4_1125: Recombinase A
*
Shewanella sp MR-7

Site:
position = -128
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Shewmr7_1196: Recombinase A
*
Shewanella baltica OS155

Site:
position = -127
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Sbal_3117: Recombinase A
*
Shewanella denitrificans OS217

Site:
position = -203
score = 5.78496
sequence = TACTGTATGATTATACAGTA

Gene: Sden_1208: Recombinase A
*
Shewanella frigidimarina NCIMB 400

Site:
position = -113
score = 5.53061
sequence = TACTGTATGACTATACAGTA

Gene: Sfri_1062: Recombinase A
*
Shewanella amazonensis SB2B

Site:
position = -115
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Sama_1046: Recombinase A
*
Shewanella loihica PV-4

Site:
position = -127
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Shew_1215: Recombinase A
*
Shewanella pealeana ATCC 700345

Site:
position = -124
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Spea_1195: Recombinase A
*
Shewanella halifaxensis HAW-EB4

Site:
position = -124
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Shal_1232: Recombinase A
*
Shewanella piezotolerans WP3

Site:
position = -123
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: swp_1366: Recombinase A
*
Shewanella sediminis HAW-EB3

Site:
position = -135
score = 5.59316
sequence = TACTGTATGATTGTACAGTA

Gene: Ssed_1300: Recombinase A
*
Shewanella woodyi ATCC 51908

Site:
position = -124
score = 5.53061
sequence = TACTGTATGACTATACAGTA

Gene: Swoo_3340: Recombinase A
Recombinase A
recX
 
Shewanella oneidensis MR-1

Gene: SO_3429: Regulatory protein RecX
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2746: Regulatory protein RecX
 
Shewanella sp W3-18-1

Gene: Sputw3181_1266: Regulatory protein RecX
 
Shewanella sp ANA-3

Gene: Shewana3_1127: Regulatory protein RecX
 
Shewanella sp MR-4

Gene: Shewmr4_1126: Regulatory protein RecX
 
Shewanella sp MR-7

Gene: Shewmr7_1197: Regulatory protein RecX
 
Shewanella baltica OS155

Gene: Sbal_3116: Regulatory protein RecX
 
Shewanella denitrificans OS217

Gene: Sden_0902: Regulatory protein RecX
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0228: Regulatory protein RecX
 
Shewanella amazonensis SB2B

Gene: Sama_1047: Regulatory protein RecX
 
Shewanella loihica PV-4

Gene: Shew_1216: Regulatory protein RecX
 
Shewanella pealeana ATCC 700345

Gene: Spea_1595: Regulatory protein RecX
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1663: Regulatory protein RecX
 
Shewanella piezotolerans WP3

Gene: swp_2411: Regulatory protein RecX
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3210: Regulatory protein RecX
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2970: Regulatory protein RecX
Regulatory protein RecX
 
CRON 9.
dinG
*
Shewanella oneidensis MR-1

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: SO_1819: ATP-dependent helicase DinG/Rad3
*
Shewanella putrefaciens CN-32

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Sputcn32_1513: ATP-dependent helicase DinG/Rad3
*
Shewanella sp W3-18-1

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Sputw3181_2587: ATP-dependent helicase DinG/Rad3
*
Shewanella sp ANA-3

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Shewana3_2630: ATP-dependent helicase DinG/Rad3
*
Shewanella sp MR-4

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Shewmr4_2470: ATP-dependent helicase DinG/Rad3
*
Shewanella sp MR-7

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Shewmr7_2538: ATP-dependent helicase DinG/Rad3
*
Shewanella baltica OS155

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Sbal_1629: ATP-dependent helicase DinG/Rad3
*
Shewanella denitrificans OS217

Site:
position = -52
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Sden_2429: ATP-dependent helicase DinG/Rad3
*
Shewanella frigidimarina NCIMB 400

Site:
position = -51
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Sfri_2630: ATP-dependent helicase DinG/Rad3
*
Shewanella amazonensis SB2B

Site:
position = -42
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Sama_1249: ATP-dependent helicase DinG/Rad3
*
Shewanella loihica PV-4

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Shew_2483: ATP-dependent helicase DinG/Rad3
*
Shewanella pealeana ATCC 700345

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Spea_2656: ATP-dependent helicase DinG/Rad3
*
Shewanella halifaxensis HAW-EB4

Site:
position = -43
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: Shal_2730: ATP-dependent helicase DinG/Rad3
*
Shewanella piezotolerans WP3

Site:
position = -10
score = 5.35513
sequence = CACTGTTATTATGTACAGCA

Gene: swp_3212: ATP-dependent helicase DinG/Rad3
*
Shewanella sediminis HAW-EB3

Site:
position = -36
score = 5.10292
sequence = CACTGTTATTATGTACAGCT

Gene: Ssed_1566: ATP-dependent helicase DinG/Rad3
*
Shewanella woodyi ATCC 51908

Site:
position = -37
score = 5.10292
sequence = CACTGTTATTATGTACAGCT

Gene: Swoo_3086: ATP-dependent helicase DinG/Rad3
ATP-dependent helicase DinG/Rad3
SO1818
 
Shewanella oneidensis MR-1

Gene: SO_1818: protein of unknown function DUF81
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1512: protein of unknown function DUF81
 
Shewanella sp W3-18-1

Gene: Sputw3181_2588: protein of unknown function DUF81
 
Shewanella sp ANA-3

Gene: Shewana3_2631: protein of unknown function DUF81
 
Shewanella sp MR-4

Gene: Shewmr4_2471: protein of unknown function DUF81
 
Shewanella sp MR-7

Gene: Shewmr7_2539: protein of unknown function DUF81
 
Shewanella baltica OS155

Gene: Sbal_1628: protein of unknown function DUF81
 
Shewanella denitrificans OS217

Gene: Sden_2430: protein of unknown function DUF81
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2631: protein of unknown function DUF81
 
Shewanella amazonensis SB2B

Gene: Sama_1248: protein of unknown function DUF81
 
Shewanella loihica PV-4

Gene: Shew_2484: protein of unknown function DUF81
 
Shewanella pealeana ATCC 700345

Gene: Spea_2657: protein of unknown function DUF81
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2731: protein of unknown function DUF81
 
Shewanella piezotolerans WP3

Gene: swp_3214: protein of unknown function DUF81
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1565: protein of unknown function DUF81
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3087: protein of unknown function DUF81
protein of unknown function DUF81
SO1817
 
Shewanella oneidensis MR-1

Gene: SO_1817: Primosomal replication protein N prime-like protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1511: Primosomal replication protein N prime-like protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_2589: Primosomal replication protein N prime-like protein
 
Shewanella sp ANA-3

Gene: Shewana3_2632: Primosomal replication protein N prime-like protein
 
Shewanella sp MR-4

Gene: Shewmr4_2472: Primosomal replication protein N prime-like protein
 
Shewanella sp MR-7

Gene: Shewmr7_2540: Primosomal replication protein N prime-like protein
 
Shewanella baltica OS155

Gene: Sbal_1627: Primosomal replication protein N prime-like protein
 
Shewanella denitrificans OS217

Gene: Sden_2431: Primosomal replication protein N prime-like protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2632: Primosomal replication protein N prime-like protein
 
Shewanella amazonensis SB2B

Gene: Sama_1247: Primosomal replication protein N prime-like protein
 
Shewanella loihica PV-4

Gene: Shew_2485: Primosomal replication protein N prime-like protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_2658: Primosomal replication protein N prime-like protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2732: Primosomal replication protein N prime-like protein
 
Shewanella piezotolerans WP3

Gene: swp_3216: Primosomal replication protein N prime-like protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1564: Primosomal replication protein N prime-like protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3088: Primosomal replication protein N prime-like protein
Primosomal replication protein N prime-like protein
 
CRON 10.
recG
*
Shewanella oneidensis MR-1

Site:
position = -45
score = 4.30174
sequence = ATATGTATAAATTCACAGTG

Gene: SO_4364: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella putrefaciens CN-32

Site:
position = -21
score = 4.30174
sequence = ATATGTATAAATTCACAGTG

Gene: Sputcn32_0450: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella sp W3-18-1

Site:
position = -21
score = 4.30174
sequence = ATATGTATAAATTCACAGTG

Gene: Sputw3181_0304: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella sp ANA-3

Site:
position = -21
score = 4.30174
sequence = ATATGTATAAATTCACAGTG

Gene: Shewana3_0348: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella sp MR-4

Site:
position = -21
score = 4.30174
sequence = ATATGTATAAATTCACAGTG

Gene: Shewmr4_0354: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella sp MR-7

Site:
position = -21
score = 4.30174
sequence = ATATGTATAAATTCACAGTG

Gene: Shewmr7_3672: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella baltica OS155

Site:
position = -21
score = 4.30174
sequence = ATATGTATAAATTCACAGTG

Gene: Sbal_0346: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella denitrificans OS217

Site:
position = -36
score = 4.81021
sequence = ATATGTATAAATTTACAGTG

Gene: Sden_3476: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -47
score = 5.31265
sequence = ATCTGTATATAATTACAGTG

Gene: Sfri_0356: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella amazonensis SB2B

Site:
position = -36
score = 4.43452
sequence = ATATGTATAAATTCACAGTA

Gene: Sama_3375: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella loihica PV-4

Site:
position = -71
score = 5.10942
sequence = ATATGTATATATTTACAGTA

Gene: Shew_3507: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella pealeana ATCC 700345

Site:
position = -21
score = 4.81021
sequence = ATATGTATAAATTTACAGTG

Gene: Spea_3884: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -21
score = 4.81021
sequence = ATATGTATAAATTTACAGTG

Gene: Shal_0385: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella piezotolerans WP3

Site:
position = -21
score = 4.81021
sequence = ATATGTATAAATTTACAGTG

Gene: swp_0309: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella sediminis HAW-EB3

Site:
position = -71
score = 4.52139
sequence = ATATGTATATAAACACAGTG

Gene: Ssed_0329: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Shewanella woodyi ATCC 51908

Site:
position = -68
score = 5.02986
sequence = ATATGTATATAAATACAGTG

Gene: Swoo_4592: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
CRON 11.
ogr
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
*
Shewanella sp W3-18-1

Site:
position = -63
score = 5.32178
sequence = TACTGTTTAAAAACACAGTG

Gene: Sputw3181_2904: phage transcriptional activator, Ogr/delta
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
*
Shewanella sp MR-7

Site:
position = -82
score = 5.86763
sequence = TACTGTTTAAAAAAACAGTA

Gene: Shewmr7_0718: phage transcriptional activator, Ogr/delta
*
Shewanella baltica OS155

Site:
position = -63
score = 5.83024
sequence = CACTGTTTAAAAATACAGTA

Gene: Sbal_1278: phage transcriptional activator, Ogr/delta
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
*
Shewanella halifaxensis HAW-EB4

Site:
position = -63
score = 5.26276
sequence = TACTGTTCAAAAACACAGTA

Gene: Shal_1316: phage transcriptional activator, Ogr/delta
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
phage transcriptional activator, Ogr/delta
 
CRON 12.
imuA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -66
score = 5.88947
sequence = TACTGTATAAATATACAGTT

Gene: Sama_1865: Predicted RecA/RadA recombinase
*
Shewanella loihica PV-4

Site:
position = -145
score = 6.09207
sequence = TACTGTATTTATATACAGTG

Gene: Shew_2102: Predicted RecA/RadA recombinase
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Predicted RecA/RadA recombinase
imuB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1864: DNA polymerase-like protein PA0670
 
Shewanella loihica PV-4

Gene: Shew_2101: DNA polymerase-like protein PA0670
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_2324: DNA polymerase-like protein PA0670
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
DNA polymerase-like protein PA0670
dnaE2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1863: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Shewanella loihica PV-4

Gene: Shew_2100: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_2325: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
DNA polymerase III alpha subunit (EC 2.7.7.7)
 
CRON 13.
xerC
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*2
Shewanella denitrificans OS217

Site:
position = -39
score = 5.3314
sequence = AACTGTATATAAACACAGTG

Gene: Sden_1131: Integron integrase IntI2

Gene: Sden_3261: Integron integrase IntI2
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -299
score = 5.46744
sequence = CGCTGTTTATTTATACAGTG

Gene: Shew_3147: Integron integrase IntI2
*
Shewanella pealeana ATCC 700345

Site:
position = -100
score = 5.30013
sequence = AACTGTATGTATATACAGCT

Gene: Spea_2629: Integron integrase IntI2
*
Shewanella halifaxensis HAW-EB4

Site:
position = -35
score = 5.65915
sequence = TACTGTATAGATAAACAGTG

Gene: Shal_1634: Integron integrase IntI2
 
Shewanella piezotolerans WP3

Gene: swp_1916: Integron integrase IntI2
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2645: Integron integrase IntI2
Integron integrase IntI2
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD