Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR2 - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1 4 2
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR2
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -127
score = 5.47784
sequence = ATGTGGAAACGTTTCCACCA

Gene: RSP_1785: Transcriptional regulator for fructose utilization, LacI family
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Transcriptional regulator for fructose utilization, LacI family
 
CRON 2.
fruB
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -169
score = 4.93225
sequence = ATCCGCAATCGTTTCCACTG

Site:
position = -60
score = 5.47784
sequence = TGGTGGAAACGTTTCCACAT

Gene: RSP_1786: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1787: 1-phosphofructokinase (EC 2.7.1.56)
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1788: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD