Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Atu5239 - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 8 2
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110 8 1
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42
Rhizobium leguminosarum bv. viciae 3841
Rhizobium sp. NGR234
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
dsd
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -64
score = 6.34682
sequence = TAATGACAACGTTACCATCA

Site:
position = -27
score = 6.12675
sequence = CAATGACAACGATACCATCG

Gene: Atu5233: D-serine deaminase
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -67
score = 6.16221
sequence = TAATGACAACGTTGTCATTC

Gene: bll3981: D-serine deaminase
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
D-serine deaminase
Atu5234
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu5234: ABC transporter, membrane spanning protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll3980: ABC transporter, membrane spanning protein
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ABC transporter, membrane spanning protein
Atu5235
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu5235: ABC transporter, membrane spanning protein (amino acid)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll3979: ABC transporter, membrane spanning protein (amino acid)
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ABC transporter, membrane spanning protein (amino acid)
Atu5236
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu5236: ABC transporter ATP-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll3978: ABC transporter ATP-binding protein
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ABC transporter ATP-binding protein
Atu5237
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu5237: ABC transporter substrate-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll3977: ABC transporter substrate-binding protein
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ABC transporter substrate-binding protein
COG0251
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -88
score = 6.34682
sequence = TGATGGTAACGTTGTCATTA

Site:
position = -125
score = 6.12675
sequence = CGATGGTATCGTTGTCATTG

Gene: Atu5232: Putative translation initiation inhibitor, yjgF family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll3976: Putative translation initiation inhibitor, yjgF family
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putative translation initiation inhibitor, yjgF family
COG3608
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu5238: Predicted deacylase
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll3975: Predicted deacylase
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Predicted deacylase
Atu5239
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu5239: Transcriptional regulator, LacI family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll3974: Transcriptional regulator, LacI family
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD