Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR3 - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 2 2
Caulobacter segnis ATCC 21756 2 2
Caulobacter sp. K31 2 2
Phenylobacterium zucineum HLK1 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglR3
*
Caulobacter crescentus CB15

Site:
position = 14
score = 5.76889
sequence = GATCTACGACGTCGCCGCGA

Gene: CC2316: Transcriptional regulator of beta-glucoside utilization, LacI family
*
Caulobacter segnis ATCC 21756

Site:
position = 14
score = 6.0806
sequence = GATCTACGACGTCGCCGCGC

Gene: Cseg_3095: Transcriptional regulator of beta-glucoside utilization, LacI family
*
Caulobacter sp. K31

Site:
position = 14
score = 5.5849
sequence = GATCTATGACGTGGCGGCGC

Gene: Caul_3555: Transcriptional regulator of beta-glucoside utilization, LacI family
*
Phenylobacterium zucineum HLK1

Site:
position = 14
score = 5.98346
sequence = GATCTACGACGTGGCGGAGC

Gene: PHZ_c2927: Transcriptional regulator of beta-glucoside utilization, LacI family
Transcriptional regulator of beta-glucoside utilization, LacI family
 
CRON 2.
bglT
*
Caulobacter crescentus CB15

Site:
position = -200
score = 5.76889
sequence = TCGCGGCGACGTCGTAGATC

Gene: CC2315: Putative beta-glucoside permease, MFS superfamily
*
Caulobacter segnis ATCC 21756

Site:
position = -252
score = 6.0806
sequence = GCGCGGCGACGTCGTAGATC

Gene: Cseg_3094: Putative beta-glucoside permease, MFS superfamily
*
Caulobacter sp. K31

Site:
position = -249
score = 5.5849
sequence = GCGCCGCCACGTCATAGATC

Gene: Caul_3554: Putative beta-glucoside permease, MFS superfamily
*
Phenylobacterium zucineum HLK1

Site:
position = -131
score = 5.98346
sequence = GCTCCGCCACGTCGTAGATC

Gene: PHZ_c2928: Putative beta-glucoside permease, MFS superfamily
Putative beta-glucoside permease, MFS superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD