Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1 4 1
Novosphingobium aromaticivorans DSM 12444 9 2
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1
Sphingopyxis alaskensis RB2256 9 2
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglX
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -34
score = 5.92646
sequence = GTTTGAGAACGTTCACAGAA

Gene: Saro_1611: Beta-glucosidase (EC 3.2.1.21)
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
*
Sphingopyxis alaskensis RB2256

Site:
position = -35
score = 5.97983
sequence = AAATGAGAACGTTCACAAGA

Gene: Sala_1511: Beta-glucosidase (EC 3.2.1.21)
 
Zymomonas mobilis subsp. mobilis ZM4
Beta-glucosidase (EC 3.2.1.21)
 
CRON 2.
omp(Bgl)
 
Erythrobacter litoralis HTCC2594
*
Erythrobacter sp. NAP1

Site:
position = -92
score = 4.96037
sequence = CCTTGTGAACGCTAACAAAA

Gene: NAP1_09747: TonB-dependent outer membrane transporter for beta-glucosides
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -78
score = 5.72672
sequence = CTGCGTGAACGTTCTCATAT

Site:
position = -60
score = 5.98533
sequence = ATAGGTGAACGTTCACAACA

Gene: Saro_1603: TonB-dependent outer membrane transporter for beta-glucosides
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
*
Sphingopyxis alaskensis RB2256

Site:
position = -84
score = 5.29717
sequence = CGAAGTGAACGTTATCATTT

Site:
position = -66
score = 6.04402
sequence = TTACGTGAACGTTCACAATC

Gene: Sala_0914: TonB-dependent outer membrane transporter for beta-glucosides
 
Zymomonas mobilis subsp. mobilis ZM4
TonB-dependent outer membrane transporter for beta-glucosides
thl1
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_1604: tryptophan halogenase, putative
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0915: tryptophan halogenase, putative
 
Zymomonas mobilis subsp. mobilis ZM4
tryptophan halogenase, putative
sapC
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_1605: Peptide transport system permease protein sapC (TC 3.A.1.5.5)
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0916: Peptide transport system permease protein sapC (TC 3.A.1.5.5)
 
Zymomonas mobilis subsp. mobilis ZM4
Peptide transport system permease protein sapC (TC 3.A.1.5.5)
Sala_0917
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_1606: Pass1-related protein
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0917: Pass1-related protein
 
Zymomonas mobilis subsp. mobilis ZM4
Pass1-related protein
thl2
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_1607: tryptophan halogenase, putative
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0918: tryptophan halogenase, putative
 
Zymomonas mobilis subsp. mobilis ZM4
tryptophan halogenase, putative
bglA
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_09742: Glucan endo-1,3-beta-D-glucosidase
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_1608: Glucan endo-1,3-beta-D-glucosidase
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0919: Glucan endo-1,3-beta-D-glucosidase
 
Zymomonas mobilis subsp. mobilis ZM4
Glucan endo-1,3-beta-D-glucosidase
bglR
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_09737: Transcriptional regulator of beta-glucoside utilization, LacI family
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_1609: Transcriptional regulator of beta-glucoside utilization, LacI family
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0920: Transcriptional regulator of beta-glucoside utilization, LacI family
 
Zymomonas mobilis subsp. mobilis ZM4
Transcriptional regulator of beta-glucoside utilization, LacI family
bglT
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_09732: Putative beta-glucoside permease, MFS superfamily
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_1610: Putative beta-glucoside permease, MFS superfamily
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0921: Putative beta-glucoside permease, MFS superfamily
 
Zymomonas mobilis subsp. mobilis ZM4
Putative beta-glucoside permease, MFS superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD