Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IdnR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 10 4
Azorhizobium caulinodans ORS 571 10 2
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1 2 2
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42 10 5
Rhizobium leguminosarum bv. viciae 3841 10 5
Rhizobium sp. NGR234 15 5
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021
Xanthobacter autotrophicus Py2 9 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
RHE_PC00147
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -57
score = 6.7736
sequence = GAATGTTATCGATAACATAT

Gene: RHE_PC00147: Sugar ABC transporter, ATP-binding protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -55
score = 6.7736
sequence = AAATGTTATCGATAACATAC

Gene: pRL100394: Sugar ABC transporter, ATP-binding protein
*
Rhizobium sp. NGR234

Site:
position = -54
score = 6.51012
sequence = TCATGTTATCGATAACATAA

Gene: NGR_b22410: Sugar ABC transporter, ATP-binding protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Sugar ABC transporter, ATP-binding protein
RHE_PC00148
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PC00148: Sugar ABC transporter, inner membrane protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL100395: Sugar ABC transporter, inner membrane protein
 
Rhizobium sp. NGR234

Gene: NGR_b22400: Sugar ABC transporter, inner membrane protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Sugar ABC transporter, inner membrane protein
RHE_PC00149
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PC00149: Sugar ABC transporter, substrate-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL100396: Sugar ABC transporter, substrate-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_b22390: Sugar ABC transporter, substrate-binding protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Sugar ABC transporter, substrate-binding protein
 
CRON 2.
idnO
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -58
score = 6.42733
sequence = GAATGTTATCGGTAACATAT

Gene: Atu4086: Gluconate 5-dehydrogenase (EC 1.1.1.69)
*
Azorhizobium caulinodans ORS 571

Site:
position = -96
score = 5.96004
sequence = TTTTGTTACCGATAACATGC

Gene: AZC_2614: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -58
score = 5.98917
sequence = TCCTGTTATCGATAACATAG

Gene: BBta_0777: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mlr3785: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -105
score = 6.81486
sequence = TTATGTTATCGATAACATAT

Gene: RHE_PC00144: Gluconate 5-dehydrogenase (EC 1.1.1.69)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -104
score = 6.81486
sequence = TTATGTTATCGATAACATAT

Gene: pRL100391: Gluconate 5-dehydrogenase (EC 1.1.1.69)
*
Rhizobium sp. NGR234

Site:
position = -48
score = 6.69799
sequence = GAATGTTATCGATAACATAA

Gene: NGR_b22270: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa0513: Gluconate 5-dehydrogenase (EC 1.1.1.69)
*
Xanthobacter autotrophicus Py2

Site:
position = -83
score = 5.65488
sequence = TCATGTTACCGATATCATGA

Gene: Xaut_2437: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Gluconate 5-dehydrogenase (EC 1.1.1.69)
Atu4687
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -83
score = 6.36887
sequence = AAATGTTATCGAGAACATTT

Site:
position = -245
score = 5.70868
sequence = CAATGATACCGATAACATGC

Gene: Atu4687: putative ABC transporter, substrate-binding component
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2615: putative ABC transporter, substrate-binding component
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -217
score = 6.45754
sequence = ATTTGTTATCGATAACATCT

Gene: NGR_b22370: putative ABC transporter, substrate-binding component
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2438: putative ABC transporter, substrate-binding component
putative ABC transporter, substrate-binding component
Atu4688
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4688: putative ABC transporter, membrane spanning protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2616: putative ABC transporter, membrane spanning protein
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_b22360: putative ABC transporter, membrane spanning protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2439: putative ABC transporter, membrane spanning protein
putative ABC transporter, membrane spanning protein
Atu4689
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4689: putative ABC transporter, membrane spanning protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2617: putative ABC transporter, membrane spanning protein
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_b22350: putative ABC transporter, membrane spanning protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2440: putative ABC transporter, membrane spanning protein
putative ABC transporter, membrane spanning protein
Atu4690
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4690: putative ABC transporter, ATPase protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2618: putative ABC transporter, ATPase protein
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_b22340: putative ABC transporter, ATPase protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2441: putative ABC transporter, ATPase protein
putative ABC transporter, ATPase protein
COG1063
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4691: Threonine dehydrogenase and related Zn-dependent dehydrogenases
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2619: Threonine dehydrogenase and related Zn-dependent dehydrogenases
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -98
score = 6.81486
sequence = ATATGTTATCGATAACATAA

Gene: RHE_PC00143: Threonine dehydrogenase and related Zn-dependent dehydrogenases
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -68
score = 6.81486
sequence = ATATGTTATCGATAACATAA

Gene: pRL100390: Threonine dehydrogenase and related Zn-dependent dehydrogenases
*
Rhizobium sp. NGR234

Site:
position = -21
score = 6.69799
sequence = TTATGTTATCGATAACATTC

Gene: NGR_b22260: Threonine dehydrogenase and related Zn-dependent dehydrogenases
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa0510: Threonine dehydrogenase and related Zn-dependent dehydrogenases
 
Xanthobacter autotrophicus Py2
Threonine dehydrogenase and related Zn-dependent dehydrogenases
idnK
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PC00145: Gluconokinase (EC 2.7.1.12)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL100392: Gluconokinase (EC 2.7.1.12)
 
Rhizobium sp. NGR234

Gene: NGR_b22280: Gluconokinase (EC 2.7.1.12)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa0514: Gluconokinase (EC 2.7.1.12)
 
Xanthobacter autotrophicus Py2
Gluconokinase (EC 2.7.1.12)
gnd
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4085: 6-phosphogluconate dehydrogenase EC=1.1.1.44
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2610: 6-phosphogluconate dehydrogenase EC=1.1.1.44
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PC00146: 6-phosphogluconate dehydrogenase EC=1.1.1.44
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL100393: 6-phosphogluconate dehydrogenase EC=1.1.1.44
 
Rhizobium sp. NGR234

Gene: NGR_b22290: 6-phosphogluconate dehydrogenase EC=1.1.1.44
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa0516: 6-phosphogluconate dehydrogenase EC=1.1.1.44
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2433: 6-phosphogluconate dehydrogenase EC=1.1.1.44
6-phosphogluconate dehydrogenase EC=1.1.1.44
SSF54909
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -70
score = 5.70868
sequence = GCATGTTATCGGTATCATTG

Site:
position = -232
score = 6.36887
sequence = AAATGTTCTCGATAACATTT

Gene: Atu4686: Dimeric alpha-beta barrel
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2612: Dimeric alpha-beta barrel
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_b22300: Dimeric alpha-beta barrel
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa0518: Dimeric alpha-beta barrel
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2435: Dimeric alpha-beta barrel
Dimeric alpha-beta barrel
idnR
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4685: Predicted transcriptional regulator of L-idonate utilization, LacI family
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2611: Predicted transcriptional regulator of L-idonate utilization, LacI family
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -114
score = 5.65215
sequence = GATTGTTATCGATATCACTG

Gene: BBta_0778: Predicted transcriptional regulator of L-idonate utilization, LacI family
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -226
score = 6.10209
sequence = ATTTGTTATCGATATCATCC

Site:
position = -131
score = 4.85223
sequence = CGATGATAGCGATAACTTTA

Gene: RHE_PC00141: Predicted transcriptional regulator of L-idonate utilization, LacI family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -268
score = 6.13644
sequence = AATTGTTATCGATATCATCT

Site:
position = -132
score = 4.85223
sequence = CGATGATAGCGATAACTTTA

Gene: pRL100388: Predicted transcriptional regulator of L-idonate utilization, LacI family
*2
Rhizobium sp. NGR234

Site:
position = -67
score = 6.45754
sequence = AGATGTTATCGATAACAAAT

Site:
position = -88
score = 4.75077
sequence = GAAGGTTATCGTTAACTTAG

Gene: NGR_b22380: Predicted transcriptional regulator of L-idonate utilization, LacI family

Gene: NGR_b22310: Predicted transcriptional regulator of L-idonate utilization, LacI family
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2434: Predicted transcriptional regulator of L-idonate utilization, LacI family
Predicted transcriptional regulator of L-idonate utilization, LacI family
idnD
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -177
score = 6.42733
sequence = ATATGTTACCGATAACATTC

Gene: Atu4087: L-idonate 5-dehydrogenase (EC 1.1.1.264)
*
Azorhizobium caulinodans ORS 571

Site:
position = -62
score = 5.96004
sequence = GCATGTTATCGGTAACAAAA

Gene: AZC_2613: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bll6831: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PC00142: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL100389: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Rhizobium sp. NGR234

Gene: NGR_b22250: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa0512: L-idonate 5-dehydrogenase (EC 1.1.1.264)
*
Xanthobacter autotrophicus Py2

Site:
position = -81
score = 5.65488
sequence = TCATGATATCGGTAACATGA

Gene: Xaut_2436: L-idonate 5-dehydrogenase (EC 1.1.1.264)
L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
CRON 3.
gnl
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll4328: Gluconolactonase (EC 3.1.1.17)
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -37
score = 6.10209
sequence = GGATGATATCGATAACAAAT

Site:
position = -132
score = 4.85223
sequence = TAAAGTTATCGCTATCATCG

Gene: RHE_PC00140: Gluconolactonase (EC 3.1.1.17)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -177
score = 4.85223
sequence = TAAAGTTATCGCTATCATCG

Site:
position = -41
score = 6.13644
sequence = AGATGATATCGATAACAATT

Gene: pRL100387: Gluconolactonase (EC 3.1.1.17)
 
Rhizobium sp. NGR234

Gene: NGR_b22240: Gluconolactonase (EC 3.1.1.17)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Gluconolactonase (EC 3.1.1.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD