Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HisR - Clostridia-3

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides pectinophilus ATCC 43243 1 1
Blautia hansenii DSM 20583 4 2
Bryantella formatexigens DSM 14469 3 1
Clostridiales bacterium 1_7_47_FAA 10 3
Clostridium bolteae ATCC BAA-613 10 3
Clostridium nexile DSM 1787 9 3
Clostridium scindens ATCC 35704 9 3
Dorea formicigenerans ATCC 27755 9 3
Dorea longicatena DSM 13814 10 3
Eubacterium eligens ATCC 27750 8 3
Eubacterium rectale ATCC 33656 9 3
Roseburia intestinalis L1-82 3 2
Ruminococcus gnavus ATCC 29149 9 3
Ruminococcus lactaris ATCC 29176 9 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hisZ
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -41
score = 5.47703
sequence = CACGTTACCACGCTAAAGTG

Gene: BACPEC_00055: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
 
Blautia hansenii DSM 20583
*
Bryantella formatexigens DSM 14469

Site:
position = -109
score = 5.09212
sequence = CACGGTACCACGCTAAAGTG

Gene: BRYFOR_02963: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -65
score = 5.07306
sequence = CACTTTACTACGAAAAAGTG

Gene: Cbac1_010100026804: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Clostridium bolteae ATCC BAA-613

Site:
position = -63
score = 4.79204
sequence = CACTTTACCATAGAAAAGCA

Gene: CLOBOL_03939: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Clostridium nexile DSM 1787

Site:
position = -40
score = 4.42194
sequence = TATTTTAATATGGTAGCGTA

Site:
position = -32
score = 4.5711
sequence = TATGGTAGCGTAATAAAGTA

Gene: CLONEX_02879: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Clostridium scindens ATCC 35704

Site:
position = -47
score = 5.13184
sequence = CATGGTAGCACACTAAAGTG

Gene: CLOSCI_00467: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Dorea formicigenerans ATCC 27755

Site:
position = -35
score = 5.01336
sequence = TATGGTAGCACGCTAAAGTG

Gene: DORFOR_01586: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Dorea longicatena DSM 13814

Site:
position = -50
score = 4.97089
sequence = CATGGTAGCACACTAAAGTA

Gene: DORLON_00474: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Eubacterium eligens ATCC 27750

Site:
position = -47
score = 4.44689
sequence = CACTTCAACGCATTAAAGCA

Gene: EUBELI_01024: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Eubacterium rectale ATCC 33656

Site:
position = 23
score = 4.64842
sequence = CACTTTACTACAAGAAAGCG

Gene: EUBREC_1685: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Roseburia intestinalis L1-82

Site:
position = -89
score = 5.0601
sequence = CAAGGTAGCACACTAAAGTG

Gene: ROSINTL182_03943: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Ruminococcus gnavus ATCC 29149

Site:
position = -37
score = 5.07438
sequence = TGTATTAGCATAGTAAAGTG

Gene: RUMGNA_02473: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Ruminococcus lactaris ATCC 29176

Site:
position = -40
score = 4.85221
sequence = CGTATTAGCAGACTAAAGTG

Gene: RUMLAC_00416: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
hisG
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_02964: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100026809: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03938: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Clostridium nexile DSM 1787

Gene: CLONEX_02878: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00468: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_01585: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Dorea longicatena DSM 13814

Gene: DORLON_00475: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01023: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1686: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_03944: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02472: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_00417: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
hisD
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_02965: Histidinol dehydrogenase (EC 1.1.1.23)
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100026814: Histidinol dehydrogenase (EC 1.1.1.23)
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03937: Histidinol dehydrogenase (EC 1.1.1.23)
 
Clostridium nexile DSM 1787

Gene: CLONEX_02877: Histidinol dehydrogenase (EC 1.1.1.23)
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00469: Histidinol dehydrogenase (EC 1.1.1.23)
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_01584: Histidinol dehydrogenase (EC 1.1.1.23)
 
Dorea longicatena DSM 13814

Gene: DORLON_00476: Histidinol dehydrogenase (EC 1.1.1.23)
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01022: Histidinol dehydrogenase (EC 1.1.1.23)
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1687: Histidinol dehydrogenase (EC 1.1.1.23)
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_00076: Histidinol dehydrogenase (EC 1.1.1.23)
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02471: Histidinol dehydrogenase (EC 1.1.1.23)
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_00418: Histidinol dehydrogenase (EC 1.1.1.23)
Histidinol dehydrogenase (EC 1.1.1.23)
DORLON_00477
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
 
Dorea longicatena DSM 13814

Gene: DORLON_00477: hypothetical protein
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149
 
Ruminococcus lactaris ATCC 29176
hypothetical protein
hisB
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100026819: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03936: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Clostridium nexile DSM 1787

Gene: CLONEX_02876: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00470: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_01583: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Dorea longicatena DSM 13814

Gene: DORLON_00478: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01021: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1688: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_00075: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02470: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_00419: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisIE
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03934: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Clostridium nexile DSM 1787

Gene: CLONEX_02875: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00471: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_01582: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Dorea longicatena DSM 13814

Gene: DORLON_00479: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1689: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_00074: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02469: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_00420: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Cbac1_010100026824
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100026824: hypothetical protein
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
 
Dorea longicatena DSM 13814
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149
 
Ruminococcus lactaris ATCC 29176
hypothetical protein
hisA
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100026829: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03935: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
 
Dorea longicatena DSM 13814
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01020: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Eubacterium rectale ATCC 33656
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149
 
Ruminococcus lactaris ATCC 29176
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
CRON 2.
hisX
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_00692: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Blautia hansenii DSM 20583

Site:
position = -61
score = 4.43487
sequence = CAATTTAGCATAGTAGAGAA

Gene: BLAHAN_01245: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01357: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -59
score = 5.59425
sequence = CACTTTAGTGTGCTAATATG

Gene: Cbac1_010100022442: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Clostridium bolteae ATCC BAA-613

Site:
position = -25
score = 5.26759
sequence = CGCTTTAGTGTGCTAATATG

Gene: CLOBOL_01668: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Clostridium nexile DSM 1787

Site:
position = -54
score = 4.82891
sequence = TAATTTAGTGTGGTAGAGTA

Gene: CLONEX_03079: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Clostridium scindens ATCC 35704

Site:
position = -91
score = 5.59682
sequence = CAATTTAGCGTGGTAAAGTA

Gene: CLOSCI_00784: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Dorea formicigenerans ATCC 27755

Site:
position = -154
score = 5.27016
sequence = CGATTTAGCGTGGTAAAGTA

Gene: DORFOR_00662: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Dorea longicatena DSM 13814

Site:
position = -94
score = 5.22472
sequence = GATTTTAGTGTGATAAAGTA

Gene: DORLON_00748: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Eubacterium eligens ATCC 27750

Site:
position = -44
score = 5.10408
sequence = TGATTTACTGTGGTAAAGTG

Gene: EUBELI_01397: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Eubacterium rectale ATCC 33656

Site:
position = -83
score = 5.16519
sequence = TACTTTAGCGTGATAATTTG

Gene: EUBREC_2005: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
 
Roseburia intestinalis L1-82
*
Ruminococcus gnavus ATCC 29149

Site:
position = -64
score = 5.52734
sequence = CAGTTTAGTATAGTAAAGTG

Gene: RUMGNA_00302: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
*
Ruminococcus lactaris ATCC 29176

Site:
position = -70
score = 4.59371
sequence = GACTTTACCATGGTGCAGTG

Gene: RUMLAC_01337: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
hisY
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583

Gene: BLAHAN_01244: Histidine ABC transporter, permease protein
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01358: Histidine ABC transporter, permease protein
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100022447: Histidine ABC transporter, permease protein
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_01669: Histidine ABC transporter, permease protein
 
Clostridium nexile DSM 1787

Gene: CLONEX_03078: Histidine ABC transporter, permease protein
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00783: Histidine ABC transporter, permease protein
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00661: Histidine ABC transporter, permease protein
 
Dorea longicatena DSM 13814

Gene: DORLON_00747: Histidine ABC transporter, permease protein
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_2004: Histidine ABC transporter, permease protein
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00303: Histidine ABC transporter, permease protein
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01338: Histidine ABC transporter, permease protein
Histidine ABC transporter, permease protein
hisZ
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_00691: Histidine ABC transporter, ATP-binding protein
 
Blautia hansenii DSM 20583

Gene: BLAHAN_01243: Histidine ABC transporter, ATP-binding protein
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01359: Histidine ABC transporter, ATP-binding protein
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100022452: Histidine ABC transporter, ATP-binding protein
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_01670: Histidine ABC transporter, ATP-binding protein
 
Clostridium nexile DSM 1787

Gene: CLONEX_03077: Histidine ABC transporter, ATP-binding protein
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00782: Histidine ABC transporter, ATP-binding protein
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00660: Histidine ABC transporter, ATP-binding protein
 
Dorea longicatena DSM 13814

Gene: DORLON_00746: Histidine ABC transporter, ATP-binding protein
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01396: Histidine ABC transporter, ATP-binding protein
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_2003: Histidine ABC transporter, ATP-binding protein
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00304: Histidine ABC transporter, ATP-binding protein
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01339: Histidine ABC transporter, ATP-binding protein
Histidine ABC transporter, ATP-binding protein
 
CRON 3.
hisR
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_00270: Predicted histidine repressor, TrpR family
*
Blautia hansenii DSM 20583

Site:
position = -68
score = 4.63229
sequence = AAATTTACTGTGCTACTATA

Gene: BLAHAN_01640: Predicted histidine repressor, TrpR family
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_00847: Predicted histidine repressor, TrpR family
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -167
score = 5.47036
sequence = AACTTTAATATGTTAAAATG

Gene: Cbac1_010100017829: Predicted histidine repressor, TrpR family
*
Clostridium bolteae ATCC BAA-613

Site:
position = -113
score = 5.5397
sequence = GACTTTAATATGCTAAAATG

Gene: CLOBOL_07128: Predicted histidine repressor, TrpR family
*
Clostridium nexile DSM 1787

Site:
position = -54
score = 4.98994
sequence = GAGTTTACTGTGCTAAAATA

Gene: CLONEX_00021: Predicted histidine repressor, TrpR family
*
Clostridium scindens ATCC 35704

Site:
position = -57
score = 5.44201
sequence = AAATTTAGTGTGTTAAAATG

Gene: CLOSCI_02856: Predicted histidine repressor, TrpR family
*
Dorea formicigenerans ATCC 27755

Site:
position = -61
score = 5.31839
sequence = AAATTTACTGTGTTAAAATG

Gene: DORFOR_03026: Predicted histidine repressor, TrpR family
*
Dorea longicatena DSM 13814

Site:
position = 24
score = 5.33518
sequence = GAATTTAGTGTGTTAAAATG

Gene: DORLON_01427: Predicted histidine repressor, TrpR family
*
Eubacterium eligens ATCC 27750

Site:
position = -68
score = 4.67833
sequence = AACTTCACTGTGTTAAAATT

Gene: EUBELI_01562: Predicted histidine repressor, TrpR family
*
Eubacterium rectale ATCC 33656

Site:
position = -37
score = 5.29104
sequence = AACTTTAATATGTTAAAATT

Gene: EUBREC_1393: Predicted histidine repressor, TrpR family
*
Roseburia intestinalis L1-82

Site:
position = -75
score = 5.64652
sequence = AACTTTAATATGCTAAAATG

Gene: ROSINTL182_04526: Predicted histidine repressor, TrpR family
*
Ruminococcus gnavus ATCC 29149

Site:
position = -58
score = 5.37932
sequence = AAATTTAGTGTGATAAAATG

Gene: RUMGNA_03779: Predicted histidine repressor, TrpR family
*
Ruminococcus lactaris ATCC 29176

Site:
position = -59
score = 5.61817
sequence = AAATTTAGTGTGCTAAAATG

Gene: RUMLAC_00772: Predicted histidine repressor, TrpR family
Predicted histidine repressor, TrpR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD