Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CceR (GapR) - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism
Effector: 6-phosphogluconate
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 177 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1 14 12
Loktanella vestfoldensis SKA53 11 9
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597 13 10
Oceanicola granulosus HTCC2516 5 5
Paracoccus denitrificans PD1222 17 10
Rhodobacter sphaeroides 2.4.1 19 8
Rhodobacterales bacterium HTCC2654 16 12
Roseobacter sp. MED193 13 11
Roseovarius nubinhibens ISM 13 8
Roseovarius sp. 217 13 8
Silicibacter TM1040 14 11
Silicibacter pomeroyi DSS-3 18 13
Sulfitobacter sp. EE-36 11 8
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pgi
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1733: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Jannaschia sp. CCS1

Gene: Jann_1971: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03196: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_07424: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_02952: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02658: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Paracoccus denitrificans PD1222

Gene: Pden_1950: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2736: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_01825: Glucose-6-phosphate isomerase (EC 5.3.1.9)
*
Roseobacter sp. MED193

Site:
position = -77
score = 4.98119
sequence = TACCGTTATCGCTAACAGTA

Gene: MED193_17414: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Roseovarius nubinhibens ISM

Gene: ISM_16490: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Roseovarius sp. 217

Gene: ROS217_18437: Glucose-6-phosphate isomerase (EC 5.3.1.9)
*
Silicibacter TM1040

Site:
position = -98
score = 5.52393
sequence = CATTGTTAGCGCTAACTTGG

Site:
position = -130
score = 3.80473
sequence = GCAAGTTTGCGAAAATTTGG

Gene: TM1040_0378: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Silicibacter pomeroyi DSS-3

Gene: SPO2046: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Sulfitobacter sp. EE-36

Gene: EE36_15782: Glucose-6-phosphate isomerase (EC 5.3.1.9)
Glucose-6-phosphate isomerase (EC 5.3.1.9)
zwf
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -37
score = 5.77205
sequence = CGCTGTTAGCGCTAACGTGA

Gene: Jann_1969: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*
Loktanella vestfoldensis SKA53

Site:
position = -42
score = 5.3109
sequence = GGGCGTTAGCGCTAACGAAA

Gene: SKA53_03186: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -47
score = 4.16478
sequence = CTATGTTAGCGCCCAAACTC

Gene: OB2597_02942: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02668: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*
Paracoccus denitrificans PD1222

Site:
position = -65
score = 4.11005
sequence = GCCTGAAACCGCTATCATCC

Gene: Pden_1952: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -38
score = 5.98931
sequence = GGCCGTTAGCGCTAACAGGC

Gene: RSP_2734: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -60
score = 4.94993
sequence = TTGGGTTAGCGCTAACAATC

Gene: RB2654_01815: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
 2
Roseobacter sp. MED193

Gene: MED193_17419: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)

Gene: MED193_04416: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
 
Roseovarius nubinhibens ISM

Gene: ISM_16500: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
 
Roseovarius sp. 217

Gene: ROS217_18447: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
 
Silicibacter TM1040

Gene: TM1040_0377: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*2
Silicibacter pomeroyi DSS-3

Site:
position = -53
score = 5.58283
sequence = AAATGTTTGCGCTAACAGTG

Gene: SPO2048: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)

Site:
position = -65
score = 5.49325
sequence = ACATGTTAGCGGTAACATTG

Gene: SPO3033: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
*
Sulfitobacter sp. EE-36

Site:
position = -66
score = 5.61079
sequence = GTATGTTTGCGCTAACATCA

Gene: EE36_15792: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
edd
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1740: Phosphogluconate dehydratase (EC 4.2.1.12)
*
Jannaschia sp. CCS1

Site:
position = -55
score = 5.83603
sequence = ACATGTTAGCGCTAACATGA

Gene: Jann_1953: Phosphogluconate dehydratase (EC 4.2.1.12)
*
Loktanella vestfoldensis SKA53

Site:
position = -58
score = 5.57412
sequence = CCTTGTTAGCGCTAACACAA

Gene: SKA53_05488: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -54
score = 5.241
sequence = CATTGTTACCGCTAACAAAG

Gene: OB2597_02267: Phosphogluconate dehydratase (EC 4.2.1.12)
*
Oceanicola granulosus HTCC2516

Site:
position = -62
score = 5.48613
sequence = GGTTGTTAGCGGTAACGGCC

Gene: OG2516_00150: Phosphogluconate dehydratase (EC 4.2.1.12)
*
Paracoccus denitrificans PD1222

Site:
position = -48
score = 5.42184
sequence = CAATGTTACCGCTAACAGGA

Gene: Pden_1955: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Rhodobacter sphaeroides 2.4.1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -65
score = 5.22499
sequence = GGTTGTTAGCGCTATCACGA

Gene: RB2654_03494: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Roseobacter sp. MED193

Gene: MED193_17424: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_0376: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3032: Phosphogluconate dehydratase (EC 4.2.1.12)
*
Sulfitobacter sp. EE-36

Site:
position = -74
score = 5.56099
sequence = ATAAGTTAGCGCTAACATAC

Gene: EE36_09240: Phosphogluconate dehydratase (EC 4.2.1.12)
Phosphogluconate dehydratase (EC 4.2.1.12)
eda
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1187: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Jannaschia sp. CCS1

Gene: Jann_1954: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_02272: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -85
score = 4.96558
sequence = CTCAGTTAACGCTAACACAC

Gene: Pden_1245: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -2160
score = 5.48681
sequence = GCTAGTTAGCGCTAACAAAC

Gene: RSP_2645: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_03489: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_0375: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3031: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Sulfitobacter sp. EE-36

Gene: EE36_09245: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
pgl
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1970: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03191: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_02947: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Oceanicola granulosus HTCC2516

Gene: OG2516_02663: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Paracoccus denitrificans PD1222

Gene: Pden_1951: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2735: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_01820: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Roseobacter sp. MED193

Gene: MED193_04411: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Roseovarius nubinhibens ISM

Gene: ISM_16495: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Roseovarius sp. 217

Gene: ROS217_18442: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Silicibacter TM1040

Gene: TM1040_1330: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Silicibacter pomeroyi DSS-3

Gene: SPO2047: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
Sulfitobacter sp. EE-36

Gene: EE36_15787: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
 
CRON 2.
atpH
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1895: ATP synthase delta chain (EC 3.6.3.14)
 
Jannaschia sp. CCS1

Gene: Jann_1046: ATP synthase delta chain (EC 3.6.3.14)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_12823: ATP synthase delta chain (EC 3.6.3.14)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09029: ATP synthase delta chain (EC 3.6.3.14)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09184: ATP synthase delta chain (EC 3.6.3.14)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08978: ATP synthase delta chain (EC 3.6.3.14)
*
Paracoccus denitrificans PD1222

Site:
position = -153
score = 4.7196
sequence = AGGTGTTTGCGCAATCGGTT

Gene: Pden_3815: ATP synthase delta chain (EC 3.6.3.14)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -288
score = 4.76178
sequence = CGATGTTAGCGGCACCATCG

Gene: RSP_2296: ATP synthase delta chain (EC 3.6.3.14)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_19863: ATP synthase delta chain (EC 3.6.3.14)
 
Roseobacter sp. MED193

Gene: MED193_20094: ATP synthase delta chain (EC 3.6.3.14)
*
Roseovarius nubinhibens ISM

Site:
position = -302
score = 4.55165
sequence = TTACGATAGCGGTAACGCCG

Gene: ISM_11730: ATP synthase delta chain (EC 3.6.3.14)
*
Roseovarius sp. 217

Site:
position = -214
score = 4.59352
sequence = CCATGATAGCGTTAACGCTT

Gene: ROS217_14311: ATP synthase delta chain (EC 3.6.3.14)
 
Silicibacter TM1040

Gene: TM1040_2089: ATP synthase delta chain (EC 3.6.3.14)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3165: ATP synthase delta chain (EC 3.6.3.14)
 
Sulfitobacter sp. EE-36

Gene: EE36_03978: ATP synthase delta chain (EC 3.6.3.14)
ATP synthase delta chain (EC 3.6.3.14)
atpA
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1894: ATP synthase alpha chain (EC 3.6.3.14)
 
Jannaschia sp. CCS1

Gene: Jann_1047: ATP synthase alpha chain (EC 3.6.3.14)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_12828: ATP synthase alpha chain (EC 3.6.3.14)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09024: ATP synthase alpha chain (EC 3.6.3.14)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09179: ATP synthase alpha chain (EC 3.6.3.14)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08973: ATP synthase alpha chain (EC 3.6.3.14)
 
Paracoccus denitrificans PD1222

Gene: Pden_3816: ATP synthase alpha chain (EC 3.6.3.14)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2297: ATP synthase alpha chain (EC 3.6.3.14)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_19868: ATP synthase alpha chain (EC 3.6.3.14)
 
Roseobacter sp. MED193

Gene: MED193_20099: ATP synthase alpha chain (EC 3.6.3.14)
 
Roseovarius nubinhibens ISM

Gene: ISM_11735: ATP synthase alpha chain (EC 3.6.3.14)
 
Roseovarius sp. 217

Gene: ROS217_14316: ATP synthase alpha chain (EC 3.6.3.14)
 
Silicibacter TM1040

Gene: TM1040_2088: ATP synthase alpha chain (EC 3.6.3.14)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3164: ATP synthase alpha chain (EC 3.6.3.14)
 
Sulfitobacter sp. EE-36

Gene: EE36_03973: ATP synthase alpha chain (EC 3.6.3.14)
ATP synthase alpha chain (EC 3.6.3.14)
atpG
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1893: ATP synthase gamma chain (EC 3.6.3.14)
 
Jannaschia sp. CCS1

Gene: Jann_1048: ATP synthase gamma chain (EC 3.6.3.14)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_12833: ATP synthase gamma chain (EC 3.6.3.14)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09019: ATP synthase gamma chain (EC 3.6.3.14)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09174: ATP synthase gamma chain (EC 3.6.3.14)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08968: ATP synthase gamma chain (EC 3.6.3.14)
 
Paracoccus denitrificans PD1222

Gene: Pden_3817: ATP synthase gamma chain (EC 3.6.3.14)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2298: ATP synthase gamma chain (EC 3.6.3.14)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_19873: ATP synthase gamma chain (EC 3.6.3.14)
 
Roseobacter sp. MED193

Gene: MED193_20104: ATP synthase gamma chain (EC 3.6.3.14)
 
Roseovarius nubinhibens ISM

Gene: ISM_11740: ATP synthase gamma chain (EC 3.6.3.14)
 
Roseovarius sp. 217

Gene: ROS217_14321: ATP synthase gamma chain (EC 3.6.3.14)
 
Silicibacter TM1040

Gene: TM1040_2087: ATP synthase gamma chain (EC 3.6.3.14)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3163: ATP synthase gamma chain (EC 3.6.3.14)
 
Sulfitobacter sp. EE-36

Gene: EE36_03968: ATP synthase gamma chain (EC 3.6.3.14)
ATP synthase gamma chain (EC 3.6.3.14)
atpD
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1892: ATP synthase beta chain (EC 3.6.3.14)
 
Jannaschia sp. CCS1

Gene: Jann_1049: ATP synthase beta chain (EC 3.6.3.14)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_12838: ATP synthase beta chain (EC 3.6.3.14)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09014: ATP synthase beta chain (EC 3.6.3.14)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09169: ATP synthase beta chain (EC 3.6.3.14)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08963: ATP synthase beta chain (EC 3.6.3.14)
 
Paracoccus denitrificans PD1222

Gene: Pden_3818: ATP synthase beta chain (EC 3.6.3.14)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2299: ATP synthase beta chain (EC 3.6.3.14)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_19878: ATP synthase beta chain (EC 3.6.3.14)
 
Roseobacter sp. MED193

Gene: MED193_20109: ATP synthase beta chain (EC 3.6.3.14)
 
Roseovarius nubinhibens ISM

Gene: ISM_11745: ATP synthase beta chain (EC 3.6.3.14)
 
Roseovarius sp. 217

Gene: ROS217_14326: ATP synthase beta chain (EC 3.6.3.14)
 
Silicibacter TM1040

Gene: TM1040_2086: ATP synthase beta chain (EC 3.6.3.14)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3162: ATP synthase beta chain (EC 3.6.3.14)
 
Sulfitobacter sp. EE-36

Gene: EE36_03963: ATP synthase beta chain (EC 3.6.3.14)
ATP synthase beta chain (EC 3.6.3.14)
atpC
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1891: ATP synthase epsilon chain (EC 3.6.3.14)
 
Jannaschia sp. CCS1

Gene: Jann_1050: ATP synthase epsilon chain (EC 3.6.3.14)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_12843: ATP synthase epsilon chain (EC 3.6.3.14)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09009: ATP synthase epsilon chain (EC 3.6.3.14)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09159: ATP synthase epsilon chain (EC 3.6.3.14)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08958: ATP synthase epsilon chain (EC 3.6.3.14)
 
Paracoccus denitrificans PD1222

Gene: Pden_3819: ATP synthase epsilon chain (EC 3.6.3.14)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2300: ATP synthase epsilon chain (EC 3.6.3.14)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_19883: ATP synthase epsilon chain (EC 3.6.3.14)
 
Roseobacter sp. MED193

Gene: MED193_20114: ATP synthase epsilon chain (EC 3.6.3.14)
 
Roseovarius nubinhibens ISM

Gene: ISM_11750: ATP synthase epsilon chain (EC 3.6.3.14)
 
Roseovarius sp. 217

Gene: ROS217_14331: ATP synthase epsilon chain (EC 3.6.3.14)
 
Silicibacter TM1040

Gene: TM1040_2085: ATP synthase epsilon chain (EC 3.6.3.14)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3161: ATP synthase epsilon chain (EC 3.6.3.14)
 
Sulfitobacter sp. EE-36

Gene: EE36_03958: ATP synthase epsilon chain (EC 3.6.3.14)
ATP synthase epsilon chain (EC 3.6.3.14)
atpI
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1051: ATP synthase protein I
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09154: ATP synthase protein I
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08953: ATP synthase protein I
 
Paracoccus denitrificans PD1222

Gene: Pden_3820: ATP synthase protein I
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_19908: ATP synthase protein I
 
Roseobacter sp. MED193

Gene: MED193_20119: ATP synthase protein I
 
Roseovarius nubinhibens ISM

Gene: ISM_11755: ATP synthase protein I
 
Roseovarius sp. 217

Gene: ROS217_14336: ATP synthase protein I
 
Silicibacter TM1040

Gene: TM1040_2084: ATP synthase protein I
 
Silicibacter pomeroyi DSS-3

Gene: SPO3160: ATP synthase protein I
 
Sulfitobacter sp. EE-36

Gene: EE36_03953: ATP synthase protein I
ATP synthase protein I
 
CRON 3.
sdhC
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3243: Succinate dehydrogenase cytochrome b-556 subunit
 
Jannaschia sp. CCS1

Gene: Jann_0811: Succinate dehydrogenase cytochrome b-556 subunit
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14576: Succinate dehydrogenase cytochrome b-556 subunit
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09259: Succinate dehydrogenase cytochrome b-556 subunit
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09559: Succinate dehydrogenase cytochrome b-556 subunit
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_0567: Succinate dehydrogenase cytochrome b-556 subunit
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -189
score = 5.09658
sequence = GCATGATTGCGCAAACATGT

Gene: RSP_0974: Succinate dehydrogenase cytochrome b-556 subunit
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17261: Succinate dehydrogenase cytochrome b-556 subunit
 
Roseobacter sp. MED193

Gene: MED193_10498: Succinate dehydrogenase cytochrome b-556 subunit
 
Roseovarius nubinhibens ISM

Gene: ISM_05000: Succinate dehydrogenase cytochrome b-556 subunit
 
Roseovarius sp. 217

Gene: ROS217_08404: Succinate dehydrogenase cytochrome b-556 subunit
 
Silicibacter TM1040

Gene: TM1040_3525: Succinate dehydrogenase cytochrome b-556 subunit
 
Silicibacter pomeroyi DSS-3

Gene: SPO0358: Succinate dehydrogenase cytochrome b-556 subunit
 
Sulfitobacter sp. EE-36

Gene: EE36_09400: Succinate dehydrogenase cytochrome b-556 subunit
Succinate dehydrogenase cytochrome b-556 subunit
sdhD
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3244: succinate dehydrogenase, cytochrome b subunit
 
Jannaschia sp. CCS1

Gene: Jann_0810: succinate dehydrogenase, cytochrome b subunit
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14581: succinate dehydrogenase, cytochrome b subunit
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09264: succinate dehydrogenase, cytochrome b subunit
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09554: succinate dehydrogenase, cytochrome b subunit
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08072: succinate dehydrogenase, cytochrome b subunit
 
Paracoccus denitrificans PD1222

Gene: Pden_0568: succinate dehydrogenase, cytochrome b subunit
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0975: succinate dehydrogenase, cytochrome b subunit
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17256: succinate dehydrogenase, cytochrome b subunit
 
Roseobacter sp. MED193

Gene: MED193_10493: succinate dehydrogenase, cytochrome b subunit
 
Roseovarius nubinhibens ISM

Gene: ISM_04995: succinate dehydrogenase, cytochrome b subunit
 
Roseovarius sp. 217

Gene: ROS217_08399: succinate dehydrogenase, cytochrome b subunit
 
Silicibacter TM1040

Gene: TM1040_3526: succinate dehydrogenase, cytochrome b subunit
 
Silicibacter pomeroyi DSS-3

Gene: SPO0359: succinate dehydrogenase, cytochrome b subunit
 
Sulfitobacter sp. EE-36

Gene: EE36_09405: succinate dehydrogenase, cytochrome b subunit
succinate dehydrogenase, cytochrome b subunit
sdhA
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3245: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Jannaschia sp. CCS1

Gene: Jann_0809: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14586: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09269: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09549: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08067: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Paracoccus denitrificans PD1222

Gene: Pden_0569: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0976: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17251: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Roseobacter sp. MED193

Gene: MED193_10488: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_04990: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Roseovarius sp. 217

Gene: ROS217_08394: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Silicibacter TM1040

Gene: TM1040_3527: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO0360: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_09410: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
RSP_0977
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_0807: hypothetical protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_0570: hypothetical protein
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0977: hypothetical protein
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM

Gene: ISM_04980: hypothetical protein
 
Roseovarius sp. 217

Gene: ROS217_08389: hypothetical protein
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36

Gene: EE36_09415: hypothetical protein
hypothetical protein
RSP_0978
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14591: hypothetical protein
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08062: hypothetical protein
 
Paracoccus denitrificans PD1222

Gene: Pden_0571: hypothetical protein
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0978: hypothetical protein
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
hypothetical protein
sdhB
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3247: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Jannaschia sp. CCS1

Gene: Jann_0804: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14601: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09274: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09539: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08052: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Paracoccus denitrificans PD1222

Gene: Pden_0572: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0979: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17246: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Roseobacter sp. MED193

Gene: MED193_10473: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_04975: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Roseovarius sp. 217

Gene: ROS217_08384: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Silicibacter TM1040

Gene: TM1040_3530: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO0361: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_09425: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
CRON 4.
pykA
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -80
score = 5.29633
sequence = GACTGATAGCGCAAACATCG

Gene: Jann_0447: Pyruvate kinase (EC 2.7.1.40)
*
Loktanella vestfoldensis SKA53

Site:
position = -39
score = 5.44726
sequence = TGCTGTTACCGCTAACGGGC

Gene: SKA53_10229: Pyruvate kinase (EC 2.7.1.40)
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -52
score = 4.04145
sequence = GATTGATAGCGTTCACATGA

Gene: OB2597_10686: Pyruvate kinase (EC 2.7.1.40)
*
Oceanicola granulosus HTCC2516

Site:
position = -74
score = 4.29591
sequence = TTGCGTTAGCGTTATCGACC

Gene: OG2516_09243: Pyruvate kinase (EC 2.7.1.40)
*
Paracoccus denitrificans PD1222

Site:
position = -32
score = 5.21762
sequence = CGACGATAGCGCAAACATGC

Gene: Pden_2276: Pyruvate kinase (EC 2.7.1.40)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1766: Pyruvate kinase (EC 2.7.1.40)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -28
score = 5.34143
sequence = GACTGTTACCGCAAACAGAC

Gene: RB2654_16676: Pyruvate kinase (EC 2.7.1.40)
*
Roseobacter sp. MED193

Site:
position = -78
score = 5.18184
sequence = TGCTGTTTGCGGTAACATTT

Gene: MED193_12017: Pyruvate kinase (EC 2.7.1.40)
*
Roseovarius nubinhibens ISM

Site:
position = -82
score = 5.06749
sequence = TGATGTTAGCGATAACGGTA

Gene: ISM_02615: Pyruvate kinase (EC 2.7.1.40)
*
Roseovarius sp. 217

Site:
position = -51
score = 5.37337
sequence = CGATGTTAGCGTTAACATTG

Gene: ROS217_12046: Pyruvate kinase (EC 2.7.1.40)
*
Silicibacter TM1040

Site:
position = -114
score = 4.90282
sequence = AAATGTTTGCGTTAACGGTC

Gene: TM1040_2516: Pyruvate kinase (EC 2.7.1.40)
*
Silicibacter pomeroyi DSS-3

Site:
position = -43
score = 5.23123
sequence = GGATGTTTGCGGTAACATAA

Gene: SPO3600: Pyruvate kinase (EC 2.7.1.40)
*
Sulfitobacter sp. EE-36

Site:
position = -128
score = 4.97747
sequence = AAGTGTTAACGCTAACACAT

Site:
position = -112
score = 5.03145
sequence = ACATGTTAACGCTAACTTAT

Gene: EE36_08598: Pyruvate kinase (EC 2.7.1.40)
Pyruvate kinase (EC 2.7.1.40)
 
CRON 5.
gapB
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -63
score = 5.35933
sequence = CCCTGTTACCGCTAACACAC

Gene: Jann_1695: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Loktanella vestfoldensis SKA53

Site:
position = -40
score = 5.59433
sequence = CAATGTTAGCGCCAACATTC

Gene: SKA53_02871: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -49
score = 5.21079
sequence = CTATGTTAGCGTTAACGGAC

Gene: OB2597_01282: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -124
score = 3.95415
sequence = CAATTGCACCGCTAACATCG

Gene: Pden_4465: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Rhodobacter sphaeroides 2.4.1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -91
score = 5.40784
sequence = TGATGTTAGCGGTAACGGCG

Gene: RB2654_02419: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Roseobacter sp. MED193

Site:
position = -110
score = 3.96176
sequence = CTCCGTTATCGATACCGATA

Site:
position = -88
score = 4.93994
sequence = TAATGTTAGCGATAACGAAT

Gene: MED193_10071: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -35
score = 5.65288
sequence = AATTGTTAGCGCTAACATAT

Gene: ROS217_23127: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Silicibacter TM1040

Site:
position = -85
score = 4.72164
sequence = CTTCGTTAGCGATAACGATA

Site:
position = -60
score = 4.45989
sequence = GAGTGATAGCGGTACCAGTG

Gene: TM1040_0417: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Silicibacter pomeroyi DSS-3

Site:
position = -59
score = 5.46883
sequence = TTTTGTTAGCGCTAACAAAT

Gene: SPO0701: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Sulfitobacter sp. EE-36

Site:
position = -35
score = 5.34563
sequence = CGATGTTAGCGCTATCAAAT

Gene: EE36_13578: Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
CRON 6.
pckA
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2705: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Jannaschia sp. CCS1

Site:
position = -138
score = 4.94501
sequence = GTATGGTTGCGCTAACTGTG

Gene: Jann_0535: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Loktanella vestfoldensis SKA53

Site:
position = -125
score = 5.15492
sequence = ATTTGGTTGCGCTAACATGC

Site:
position = -105
score = 4.84322
sequence = ATTTGGTTGCGCTAACGTTT

Gene: SKA53_13138: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -168
score = 4.4791
sequence = GGGTGATTGCGCTAAAGTTT

Site:
position = -148
score = 4.73849
sequence = ACTTGGTGGCGCTAACTGCG

Gene: OB2597_10169: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Oceanicola granulosus HTCC2516

Site:
position = -124
score = 4.73706
sequence = CGCGGGTTGCGCTAACATCA

Site:
position = -103
score = 5.01824
sequence = CCTTGGTTGCGCTAACTGCG

Gene: OG2516_08708: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Paracoccus denitrificans PD1222

Site:
position = -132
score = 4.59972
sequence = AAATGATTGCGCTAACCGTC

Site:
position = -113
score = 4.52695
sequence = CTCTGATTGCGCTAACCCTG

Gene: Pden_2852: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -188
score = 3.93578
sequence = CGGAGGTTGCGCCAACCTGT

Site:
position = -168
score = 5.2328
sequence = CGCTGGTTGCGCTAACGTCT

Gene: RSP_1680: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -230
score = 4.96415
sequence = TGGTGGTTGCGCAAACAGCC

Site:
position = -209
score = 4.622
sequence = CATTGCTTGCGCTAACGCGA

Gene: RB2654_15911: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Roseobacter sp. MED193

Site:
position = -183
score = 4.26264
sequence = CAATGGTTGCGCTAAACTCC

Site:
position = -162
score = 4.77481
sequence = CCTTGGTGGCGCTAACTGCG

Site:
position = -95
score = 3.71284
sequence = AACCGGTGGCGATACCGGCA

Gene: MED193_16479: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Roseovarius nubinhibens ISM

Site:
position = -174
score = 5.28988
sequence = CGCTGGTTGCGCTAACGTCC

Site:
position = -154
score = 4.63433
sequence = AATTGGTTGCGCTAACTCAG

Gene: ISM_13535: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*2
Roseovarius sp. 217

Site:
position = -197
score = 4.79233
sequence = GCGCGTTGTCGCTAACATAC

Site:
position = -177
score = 5.07073
sequence = GTCTGGTTGCGCTAACTTGC

Site:
position = -157
score = 4.89727
sequence = GCTTGGTTGCGCTAACTGCA

Gene: ROS217_04095: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)

Site:
position = -77
score = 4.79502
sequence = AAGTGATTGCGCTAACTTGG

Gene: ROS217_15745: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Silicibacter TM1040

Site:
position = -198
score = 4.04578
sequence = TTTTGGTGGCGCTAAAGGTT

Site:
position = -177
score = 5.05137
sequence = GCTTGGTTGCGCTAACGACC

Gene: TM1040_2442: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Silicibacter pomeroyi DSS-3

Site:
position = -172
score = 3.96983
sequence = TCTTGGTTGCGCTAAACTAT

Site:
position = -151
score = 5.01824
sequence = CCTTGGTTGCGCTAACTGCG

Gene: SPO0709: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
*
Sulfitobacter sp. EE-36

Site:
position = -158
score = 4.75877
sequence = GACAGTTTCCGCAAACAGTT

Site:
position = -138
score = 4.84344
sequence = ACATGGTGGCGCTAACTGCG

Gene: EE36_04888: Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
Phosphoenolpyruvate carboxykinase (EC 4.1.1.49)
 
CRON 7.
gapA
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -128
score = 4.91749
sequence = CCGTGTTAGCGCCACCACCC

Site:
position = -109
score = 4.61602
sequence = CGATGTTTGCGCCACCGTTT

Site:
position = -97
score = 5.21564
sequence = CACCGTTTCCGCTAACATGC

Gene: Jann_1698: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Loktanella vestfoldensis SKA53

Site:
position = -135
score = 5.10712
sequence = GAATGTTGGCGCAAACATTT

Site:
position = -122
score = 4.67204
sequence = AACATTTAGCGGTAACAGCA

Site:
position = -93
score = 4.98102
sequence = GTCTGTTACCGTTAACACCC

Gene: SKA53_02881: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08164: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Oceanicola batsensis HTCC2597

Site:
position = -141
score = 4.86757
sequence = GCCTGTTAGCGCCAACCCTC

Site:
position = -119
score = 4.91545
sequence = ACGGGTTAGCGCCAACAGGC

Site:
position = -100
score = 4.3611
sequence = CCGGTTTATCGCTAACATAC

Gene: OB2597_01292: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -176
score = 4.72272
sequence = CCGCGTTTGCGTTAACGGTT

Site:
position = -164
score = 4.34998
sequence = TAACGGTTCCGCTAACGCCC

Site:
position = -134
score = 5.12834
sequence = ATATGTTTTCGCTAACACGC

Gene: RB2654_02429: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Roseobacter sp. MED193

Site:
position = -132
score = 4.51909
sequence = AAGCGTTAGCGCCACCGTGT

Site:
position = -99
score = 3.93982
sequence = TCCCGTTAACGCCACCGGTA

Site:
position = -77
score = 4.10276
sequence = AACCGTTAACGCCACCGGTC

Site:
position = -58
score = 4.63593
sequence = CTAGTTTTGCGCTAACATAC

Gene: MED193_03557: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Roseovarius nubinhibens ISM

Site:
position = -105
score = 4.60421
sequence = GAAATTTATCGCTAACAAGG

Gene: ISM_10930: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Roseovarius sp. 217

Site:
position = -150
score = 4.74721
sequence = TTGCGTTAGCGCAATCACCG

Site:
position = -109
score = 4.88045
sequence = CTAGGTTAACGCTAACATCC

Gene: ROS217_23117: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Silicibacter TM1040

Site:
position = -150
score = 4.77904
sequence = AACAGTTACCGCAAACGCCG

Site:
position = -126
score = 4.29756
sequence = AGGTGTTAACGCCACCATCA

Site:
position = -107
score = 4.46636
sequence = AAGGTTTTGCGCTAACAGTC

Gene: TM1040_1111: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Silicibacter pomeroyi DSS-3

Site:
position = -123
score = 4.83285
sequence = AAGCGTTAGCGCAACCGGGG

Site:
position = -104
score = 5.39997
sequence = GCAAGTTTGCGCTAACACCT

Gene: SPO2198: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Sulfitobacter sp. EE-36

Site:
position = -129
score = 4.56103
sequence = GAGGGTTATCGCTAACACGA

Site:
position = -110
score = 4.48925
sequence = AATATTTATCGCTAACATAC

Gene: EE36_13588: Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
Gllyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
CRON 8.
cceR2
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
*
Roseobacter sp. MED193

Site:
position = -119
score = 4.93994
sequence = ATTCGTTATCGCTAACATTA

Gene: MED193_10066: Transcriptional regulator, LacI family
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Transcriptional regulator, LacI family
 
CRON 9.
pycA
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_2781: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_07351: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_16100: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_00115: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Paracoccus denitrificans PD1222

Gene: Pden_4144: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2090: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06137: Pyruvate carboxyl transferase (EC 6.4.1.1)
*
Roseobacter sp. MED193

Site:
position = -104
score = 4.17709
sequence = GAATGAGAGCGCAATCATGC

Gene: MED193_07548: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_16910: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Roseovarius sp. 217

Gene: ROS217_21927: Pyruvate carboxyl transferase (EC 6.4.1.1)
*
Silicibacter TM1040

Site:
position = -102
score = 4.46569
sequence = GCAAGTGAGCGCAATCATGC

Gene: TM1040_2028: Pyruvate carboxyl transferase (EC 6.4.1.1)
*
Silicibacter pomeroyi DSS-3

Site:
position = -104
score = 4.42921
sequence = GGATGCGAGCGATAACATGC

Gene: SPO1171: Pyruvate carboxyl transferase (EC 6.4.1.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_17042: Pyruvate carboxyl transferase (EC 6.4.1.1)
Pyruvate carboxyl transferase (EC 6.4.1.1)
 
CRON 10.
mdh
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3218: Malate dehydrogenase (EC 1.1.1.37)
*
Jannaschia sp. CCS1

Site:
position = -101
score = 4.08899
sequence = GGGCGTTGGGGCTATCGGCC

Gene: Jann_0818: Malate dehydrogenase (EC 1.1.1.37)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14541: Malate dehydrogenase (EC 1.1.1.37)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_09359: Malate dehydrogenase (EC 1.1.1.37)
*
Oceanicola batsensis HTCC2597

Site:
position = -60
score = 3.67223
sequence = CGCTGATCCCGCAAAATGCC

Gene: OB2597_09589: Malate dehydrogenase (EC 1.1.1.37)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08112: Malate dehydrogenase (EC 1.1.1.37)
 
Paracoccus denitrificans PD1222

Gene: Pden_0561: Malate dehydrogenase (EC 1.1.1.37)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -70
score = 5.04944
sequence = TGCCTTTAGCGCAAACATCT

Gene: RSP_0968: Malate dehydrogenase (EC 1.1.1.37)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -121
score = 4.37781
sequence = CACCTTTAGCGGTATCAACG

Gene: RB2654_17316: Malate dehydrogenase (EC 1.1.1.37)
 
Roseobacter sp. MED193

Gene: MED193_10538: Malate dehydrogenase (EC 1.1.1.37)
 
Roseovarius nubinhibens ISM

Gene: ISM_05055: Malate dehydrogenase (EC 1.1.1.37)
 
Roseovarius sp. 217

Gene: ROS217_06920: Malate dehydrogenase (EC 1.1.1.37)
 
Silicibacter TM1040

Gene: TM1040_3517: Malate dehydrogenase (EC 1.1.1.37)
*
Silicibacter pomeroyi DSS-3

Site:
position = -130
score = 4.8194
sequence = CGCTTTTAGCGCAATCACCC

Gene: SPO0349: Malate dehydrogenase (EC 1.1.1.37)
 
Sulfitobacter sp. EE-36

Gene: EE36_09395: Malate dehydrogenase (EC 1.1.1.37)
Malate dehydrogenase (EC 1.1.1.37)
 
CRON 11.
tal
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_3235: Transaldolase (EC 2.2.1.2)
*
Jannaschia sp. CCS1

Site:
position = -71
score = 5.69881
sequence = TTCCGTTAGCGCTAACATGC

Gene: Jann_1032: Transaldolase (EC 2.2.1.2)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_09619: Transaldolase (EC 2.2.1.2)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_07484: Transaldolase (EC 2.2.1.2)
*
Oceanicola batsensis HTCC2597

Site:
position = -133
score = 4.79561
sequence = TTTCGTTAGCGCTAGCAGAA

Gene: OB2597_15590: Transaldolase (EC 2.2.1.2)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_14516: Transaldolase (EC 2.2.1.2)
 
Paracoccus denitrificans PD1222

Gene: Pden_2499: Transaldolase (EC 2.2.1.2)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0561: Transaldolase (EC 2.2.1.2)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -47
score = 4.19251
sequence = GTATGACACCGCTAACATTT

Gene: RB2654_18993: Transaldolase (EC 2.2.1.2)
*
Roseobacter sp. MED193

Site:
position = -48
score = 3.98783
sequence = AAAGGCTAGCGCAATCAAGG

Gene: MED193_09260: Transaldolase (EC 2.2.1.2)
*
Roseovarius nubinhibens ISM

Site:
position = -123
score = 3.60535
sequence = GGCGGTTTGCGGCAAATTAT

Gene: ISM_03480: Transaldolase (EC 2.2.1.2)
 
Roseovarius sp. 217

Gene: ROS217_22537: Transaldolase (EC 2.2.1.2)
*
Silicibacter TM1040

Site:
position = -129
score = 5.31407
sequence = CGCTGTTTACGCTAACATGC

Gene: TM1040_2379: Transaldolase (EC 2.2.1.2)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3128: Transaldolase (EC 2.2.1.2)
 
Sulfitobacter sp. EE-36

Gene: EE36_09675: Transaldolase (EC 2.2.1.2)
Transaldolase (EC 2.2.1.2)
 
CRON 12.
cceR
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_0311: Transcriptional regulator for central carbohydrate metabolism, LacI family
 
Loktanella vestfoldensis SKA53

Gene: SKA53_12393: Transcriptional regulator for central carbohydrate metabolism, LacI family
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_14566: Transcriptional regulator for central carbohydrate metabolism, LacI family
 
Oceanicola granulosus HTCC2516

Gene: OG2516_09665: Transcriptional regulator for central carbohydrate metabolism, LacI family
*
Paracoccus denitrificans PD1222

Site:
position = -39
score = 4.05629
sequence = AAAAGATAACGGTAACATGA

Gene: Pden_1978: Transcriptional regulator for central carbohydrate metabolism, LacI family
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -98
score = 5.47667
sequence = GGCCGTTATCGCTAACATGG

Gene: RSP_1663: Transcriptional regulator for central carbohydrate metabolism, LacI family
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_15484: Transcriptional regulator for central carbohydrate metabolism, LacI family
 
Roseobacter sp. MED193

Gene: MED193_14932: Transcriptional regulator for central carbohydrate metabolism, LacI family
*
Roseovarius nubinhibens ISM

Site:
position = -48
score = 4.55831
sequence = CACCGTTCGCGATAACATTT

Gene: ISM_08560: Transcriptional regulator for central carbohydrate metabolism, LacI family
*
Roseovarius sp. 217

Site:
position = -46
score = 4.56041
sequence = GGGCGTTCGCGGTAACAATG

Gene: ROS217_09370: Transcriptional regulator for central carbohydrate metabolism, LacI family
 
Silicibacter TM1040

Gene: TM1040_3128: Transcriptional regulator for central carbohydrate metabolism, LacI family
*
Silicibacter pomeroyi DSS-3

Site:
position = -49
score = 4.59427
sequence = TGCCGTTCGCGCTAGCATCG

Gene: SPO3684: Transcriptional regulator for central carbohydrate metabolism, LacI family
 
Sulfitobacter sp. EE-36

Gene: EE36_07953: Transcriptional regulator for central carbohydrate metabolism, LacI family
Transcriptional regulator for central carbohydrate metabolism, LacI family
PF06224
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_14561: protein of unknown function DUF1006
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193

Gene: MED193_14937: protein of unknown function DUF1006
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO3685: protein of unknown function DUF1006
 
Sulfitobacter sp. EE-36

Gene: EE36_07948: protein of unknown function DUF1006
protein of unknown function DUF1006
 
CRON 13.
fba
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -80
score = 4.80324
sequence = GCCTGATAGCGCAACCATGA

Gene: Jann_1693: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Loktanella vestfoldensis SKA53

Site:
position = -104
score = 5.27298
sequence = CGCCGTTTGCGATAACATCC

Site:
position = -83
score = 5.08957
sequence = GTCCGTTCGCGCTAACATAT

Gene: SKA53_05615: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -100
score = 5.22854
sequence = GGGCGTTAGCGCCAACGGGC

Gene: OB2597_04490: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Oceanicola granulosus HTCC2516

Site:
position = -82
score = 4.99268
sequence = CCCCGGTGGCGCTAACAGGT

Gene: OG2516_03238: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Paracoccus denitrificans PD1222

Site:
position = -74
score = 4.58911
sequence = TTCCGTTAGCGCAATCGCGA

Gene: Pden_1920: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -79
score = 4.86649
sequence = CCAAGTTAGCGCGAACAACA

Gene: RSP_4045: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -81
score = 4.37147
sequence = ATGCGTTAGCGCGACCAGAA

Gene: RB2654_05195: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Roseobacter sp. MED193

Site:
position = -100
score = 4.73747
sequence = GCCCGTTAGCGCAAGCGCTT

Gene: MED193_20764: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Roseovarius nubinhibens ISM

Site:
position = -80
score = 4.57869
sequence = AGGCGTTAGCGCCACCAAGA

Gene: ISM_04665: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Roseovarius sp. 217

Site:
position = -85
score = 4.66792
sequence = TTCTGTTAGCGCCACCACGA

Gene: ROS217_17772: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Silicibacter TM1040

Site:
position = -105
score = 5.02094
sequence = GGGCGTTAGCGCAACCATTG

Gene: TM1040_1976: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
*
Silicibacter pomeroyi DSS-3

Site:
position = -83
score = 4.34295
sequence = GTAGTTGAGCGCTAACATCC

Gene: SPO1899: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
 
Sulfitobacter sp. EE-36

Gene: EE36_15612: Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
Fructose-bisphosphate aldolase class I (EC 4.1.2.13)
 
CRON 14.
eno
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1980: Enolase (EC 4.2.1.11)
*
Jannaschia sp. CCS1

Site:
position = -84
score = 5.35326
sequence = GCCTGTTACCGCTAACGGAA

Gene: Jann_1797: Enolase (EC 4.2.1.11)
*
Loktanella vestfoldensis SKA53

Site:
position = -38
score = 5.11504
sequence = CACTGATACCGCTAACATCG

Gene: SKA53_03091: Enolase (EC 4.2.1.11)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_02606: Enolase (EC 4.2.1.11)
*
Oceanicola batsensis HTCC2597

Site:
position = -97
score = 5.26688
sequence = ATCTGTTTGCGCAAACGCCC

Gene: OB2597_02982: Enolase (EC 4.2.1.11)
*
Oceanicola granulosus HTCC2516

Site:
position = -36
score = 5.13666
sequence = GTCCGATAGCGCAAACATCT

Gene: OG2516_03740: Enolase (EC 4.2.1.11)
 
Paracoccus denitrificans PD1222

Gene: Pden_4060: Enolase (EC 4.2.1.11)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2491: Enolase (EC 4.2.1.11)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -85
score = 4.44282
sequence = CACCGTTGGCGCAACCGCCC

Gene: RB2654_03084: Enolase (EC 4.2.1.11)
*
Roseobacter sp. MED193

Site:
position = -136
score = 4.52696
sequence = TACCGGTGGCGCAAACAGGT

Site:
position = -116
score = 4.03552
sequence = GAATGGTAACGTTAACTGTG

Site:
position = -87
score = 5.05922
sequence = TGCCGTTAGCGGTAACGAAG

Gene: MED193_22551: Enolase (EC 4.2.1.11)
*
Roseovarius nubinhibens ISM

Site:
position = -85
score = 5.18488
sequence = TCGTGTTAGCGATAACATAT

Site:
position = -126
score = 4.08704
sequence = AACCGTTACCGGCATCATCG

Gene: ISM_16480: Enolase (EC 4.2.1.11)
 
Roseovarius sp. 217

Gene: ROS217_21722: Enolase (EC 4.2.1.11)
*
Silicibacter TM1040

Site:
position = -214
score = 4.10657
sequence = AAGGGTGAGCGCTATCATCT

Site:
position = -89
score = 5.09232
sequence = AGCCGTTAGCGGTAACGCTT

Gene: TM1040_0931: Enolase (EC 4.2.1.11)
*
Silicibacter pomeroyi DSS-3

Site:
position = -137
score = 5.41595
sequence = CGCTGTTGGCGCAAACAGGG

Site:
position = -117
score = 4.86259
sequence = ATGTGTTAGCCCTAACTGCG

Site:
position = -88
score = 4.85504
sequence = GCGTGTTAGCGATAGCAGTC

Gene: SPO2474: Enolase (EC 4.2.1.11)
*
Sulfitobacter sp. EE-36

Site:
position = -148
score = 4.68659
sequence = CTATGTTGGCGCAACCATCA

Gene: EE36_15917: Enolase (EC 4.2.1.11)
Enolase (EC 4.2.1.11)
 
CRON 15.
yedI
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -148
score = 4.91749
sequence = GGGTGGTGGCGCTAACACGG

Site:
position = -167
score = 4.61602
sequence = AAACGGTGGCGCAAACATCG

Site:
position = -179
score = 5.21564
sequence = GCATGTTAGCGGAAACGGTG

Gene: Jann_1699: conserved inner membrane protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09279: conserved inner membrane protein
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_2188: conserved inner membrane protein
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2958: conserved inner membrane protein
*
Rhodobacterales bacterium HTCC2654

Site:
position = -138
score = 4.34998
sequence = GGGCGTTAGCGGAACCGTTA

Site:
position = -126
score = 4.72272
sequence = AACCGTTAACGCAAACGCGG

Site:
position = -168
score = 5.12834
sequence = GCGTGTTAGCGAAAACATAT

Gene: RB2654_02434: conserved inner membrane protein
*
Roseobacter sp. MED193

Site:
position = -156
score = 4.63593
sequence = GTATGTTAGCGCAAAACTAG

Site:
position = -137
score = 4.10276
sequence = GACCGGTGGCGTTAACGGTT

Site:
position = -82
score = 4.51909
sequence = ACACGGTGGCGCTAACGCTT

Gene: MED193_03562: conserved inner membrane protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_07160: conserved inner membrane protein
*
Silicibacter TM1040

Site:
position = -124
score = 4.77904
sequence = CGGCGTTTGCGGTAACTGTT

Site:
position = -148
score = 4.29756
sequence = TGATGGTGGCGTTAACACCT

Site:
position = -167
score = 4.46636
sequence = GACTGTTAGCGCAAAACCTT

Gene: TM1040_1112: conserved inner membrane protein
*
Silicibacter pomeroyi DSS-3

Site:
position = -99
score = 5.39997
sequence = AGGTGTTAGCGCAAACTTGC

Site:
position = -80
score = 4.83285
sequence = CCCCGGTTGCGCTAACGCTT

Gene: SPO2197: conserved inner membrane protein
*
Sulfitobacter sp. EE-36

Site:
position = -83
score = 4.56103
sequence = TCGTGTTAGCGATAACCCTC

Site:
position = -102
score = 4.48925
sequence = GTATGTTAGCGATAAATATT

Gene: EE36_13593: conserved inner membrane protein
conserved inner membrane protein
 
CRON 16.
scrK
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -40
score = 4.8023
sequence = AAAGGTTACCGCTAACACGT

Gene: Jann_2674: Fructokinase (EC 2.7.1.4)
*
Loktanella vestfoldensis SKA53

Site:
position = -40
score = 5.40641
sequence = ATTTGTTATCGCTAACAGCC

Gene: SKA53_01436: Fructokinase (EC 2.7.1.4)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_06047: Fructokinase (EC 2.7.1.4)
*
Paracoccus denitrificans PD1222

Site:
position = -77
score = 4.8528
sequence = GGCAGTTACCGCTATCAGGA

Gene: Pden_2946: Fructokinase (EC 2.7.1.4)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2257: Fructokinase (EC 2.7.1.4)
*2
Rhodobacterales bacterium HTCC2654

Site:
position = -36
score = 5.05161
sequence = GACTGATACCGCTAACAACC

Site:
position = -68
score = 4.0791
sequence = GGGTGATTGCGCAATCCGCG

Gene: RB2654_08617: Fructokinase (EC 2.7.1.4)

Gene: RB2654_08622: Fructokinase (EC 2.7.1.4)
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
*
Silicibacter TM1040

Site:
position = -93
score = 4.71903
sequence = AAATGTTAGCGCTTTCAGGT

Gene: TM1040_3042: Fructokinase (EC 2.7.1.4)
*
Silicibacter pomeroyi DSS-3

Site:
position = -48
score = 3.77792
sequence = GCCGGTTTGCGCTGAGATGC

Gene: SPOA0276: Fructokinase (EC 2.7.1.4)
 
Sulfitobacter sp. EE-36
Fructokinase (EC 2.7.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD