Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AZL_a08610 - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Gluconacetobacter diazotrophicus PAl 5
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Magnetospirillum magneticum AMB-1
Magnetospirillum magnetotacticum MS-1
Azospirillum sp. B510 5 2
Acetobacter pasteurianus IFO 3283-01
Rhodospirillum centenum SW
Rhodospirillum rubrum ATCC 11170
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
dctP
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
*
Azospirillum sp. B510

Site:
position = -174
score = 5.03036
sequence = TTTTGAAAGCGGTTACATAT

Site:
position = -107
score = 6.33379
sequence = CTATGTAAGCGCTTACATCG

Gene: AZL_a08600: C4-dicarboxylate ABC transporter, periplasmic component
 
Acetobacter pasteurianus IFO 3283-01
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
C4-dicarboxylate ABC transporter, periplasmic component
dapA
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Azospirillum sp. B510

Gene: AZL_a08590: dihydrodipicolinate synthase
 
Acetobacter pasteurianus IFO 3283-01
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
dihydrodipicolinate synthase
dctQ
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Azospirillum sp. B510

Gene: AZL_a08580: C4-dicarboxylate ABC transporter, small permease component
 
Acetobacter pasteurianus IFO 3283-01
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
C4-dicarboxylate ABC transporter, small permease component
dctM
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Azospirillum sp. B510

Gene: AZL_a08570: C4-dicarboxylate ABC transporter, large permease component
 
Acetobacter pasteurianus IFO 3283-01
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
C4-dicarboxylate ABC transporter, large permease component
 
CRON 2.
AZL_a08610
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
*
Azospirillum sp. B510

Site:
position = -114
score = 6.33379
sequence = CGATGTAAGCGCTTACATAG

Site:
position = -47
score = 5.03036
sequence = ATATGTAACCGCTTTCAAAA

Gene: AZL_a08610: Transcriptional regulator, LacI family
 
Acetobacter pasteurianus IFO 3283-01
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD