Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AfrR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: 1,5-Anhydro-d-Fructose utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon)
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M 12 2
Mesorhizobium loti MAFF303099 14 2
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42 12 1
Rhizobium leguminosarum bv. viciae 3841 12 1
Rhizobium sp. NGR234 6 2
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021 12 2
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF06187
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
*
Brucella melitensis 16M

Site:
position = -223
score = 5.82807
sequence = TAATTGGAACGTTCCAAGAC

Site:
position = -56
score = 5.87757
sequence = CATTTGGAACGTTCTAAACT

Gene: BMEI0018: Protein of unknown function DUF993
*
Mesorhizobium loti MAFF303099

Site:
position = -209
score = 5.65678
sequence = CTATTGGAACGTTCTAATCC

Site:
position = -45
score = 5.56413
sequence = TTATTGGAACGTTCCATTTA

Gene: mll3044: Protein of unknown function DUF993
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -246
score = 6.29205
sequence = TAATTGGAACGTTCCAATTT

Site:
position = -49
score = 6.01999
sequence = AATTTGGAACGATCTAAATT

Gene: NGR_c32990: Protein of unknown function DUF993
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -260
score = 6.29205
sequence = TAATTGGAACGTTCCAATTT

Site:
position = -56
score = 6.01999
sequence = AATTTGGAACGATCTAAATT

Gene: SMc04402: Protein of unknown function DUF993
 
Xanthobacter autotrophicus Py2
Protein of unknown function DUF993
 
CRON 2.
afrR
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
*
Brucella melitensis 16M

Site:
position = -154
score = 5.87757
sequence = AGTTTAGAACGTTCCAAATG

Gene: BMEI0019: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
*
Mesorhizobium loti MAFF303099

Site:
position = -216
score = 5.56413
sequence = TAAATGGAACGTTCCAATAA

Site:
position = -52
score = 5.65678
sequence = GGATTAGAACGTTCCAATAG

Gene: mlr3045: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -153
score = 5.20615
sequence = GATTTAAATCGTTCCAAAAG

Site:
position = -57
score = 6.00122
sequence = TTTTTGGAACGTTCCAAATA

Gene: RHE_CH01719: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -161
score = 5.78575
sequence = TTTTTAGATCGTTCCAAATT

Site:
position = -56
score = 6.18712
sequence = CAATTGGAACGTTCCAAATA

Gene: RL1820: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
*
Rhizobium sp. NGR234

Site:
position = -254
score = 6.01999
sequence = AATTTAGATCGTTCCAAATT

Site:
position = -57
score = 6.29205
sequence = AAATTGGAACGTTCCAATTA

Gene: NGR_c33000: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -261
score = 6.01999
sequence = AATTTAGATCGTTCCAAATT

Site:
position = -57
score = 6.29205
sequence = AAATTGGAACGTTCCAATTA

Gene: SMc04401: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
 
Xanthobacter autotrophicus Py2
Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
afr
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEI0020: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
 
Mesorhizobium loti MAFF303099

Gene: mlr3046: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c33010: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04400: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
 
Xanthobacter autotrophicus Py2
1,5-anhydro-D-fructose reductase EC=1.1.1.292
ydiF
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEI0021: putative CoA-transferase
 
Mesorhizobium loti MAFF303099

Gene: mlr3047: putative CoA-transferase
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01720: putative CoA-transferase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1821: putative CoA-transferase
 
Rhizobium sp. NGR234

Gene: NGR_c33020: putative CoA-transferase
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04399: putative CoA-transferase
 
Xanthobacter autotrophicus Py2
putative CoA-transferase
crt
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 2
Brucella melitensis 16M

Gene: BMEI0023: putative enoyl-CoA hydratase

Gene: BMEI0022: putative enoyl-CoA hydratase
 
Mesorhizobium loti MAFF303099

Gene: mlr3048: putative enoyl-CoA hydratase
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01721: putative enoyl-CoA hydratase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1822: putative enoyl-CoA hydratase
 
Rhizobium sp. NGR234

Gene: NGR_c33030: putative enoyl-CoA hydratase
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04398: putative enoyl-CoA hydratase
 
Xanthobacter autotrophicus Py2
putative enoyl-CoA hydratase
aldh
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEI0024: putative aldehyde dehydrogenase
 
Mesorhizobium loti MAFF303099

Gene: mlr3049: putative aldehyde dehydrogenase
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01722: putative aldehyde dehydrogenase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1823: putative aldehyde dehydrogenase
 
Rhizobium sp. NGR234

Gene: NGR_c33040: putative aldehyde dehydrogenase
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04397: putative aldehyde dehydrogenase
 
Xanthobacter autotrophicus Py2
putative aldehyde dehydrogenase
RHE_CH01723
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mlr3050: Sugar ABC transporter, substrate-binding protein
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01723: Sugar ABC transporter, substrate-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1824: Sugar ABC transporter, substrate-binding protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04396: Sugar ABC transporter, substrate-binding protein
 
Xanthobacter autotrophicus Py2
Sugar ABC transporter, substrate-binding protein
BMEII0591
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mlr3052: Sugar ABC transporter, inner membrane protein
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01724: Sugar ABC transporter, inner membrane protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1825: Sugar ABC transporter, inner membrane protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04395: Sugar ABC transporter, inner membrane protein
 
Xanthobacter autotrophicus Py2
Sugar ABC transporter, inner membrane protein
mlr6653
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mlr3053: Sugar ABC transporter, inner membrane protein
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01725: Sugar ABC transporter, inner membrane protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1826: Sugar ABC transporter, inner membrane protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04394: Sugar ABC transporter, inner membrane protein
 
Xanthobacter autotrophicus Py2
Sugar ABC transporter, inner membrane protein
blr4845
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mlr3054: Sugar ABC transporter, ATP-binding protein
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01726: Sugar ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1827: Sugar ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04393: Sugar ABC transporter, ATP-binding protein
 
Xanthobacter autotrophicus Py2
Sugar ABC transporter, ATP-binding protein
BMEI0025
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEI0025: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
 
Mesorhizobium loti MAFF303099

Gene: mlr3056: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01727: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1828: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04392: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
 
Xanthobacter autotrophicus Py2
Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
fabG
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEI0026: putative oxidoreductase
 
Mesorhizobium loti MAFF303099

Gene: mlr3057: putative oxidoreductase
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc04391: putative oxidoreductase
 
Xanthobacter autotrophicus Py2
putative oxidoreductase
BMEI0029
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 3
Brucella melitensis 16M

Gene: BMEI0028: Oxidoreductase, GMC family

Gene: BMEI0029: Oxidoreductase, GMC family

Gene: BMEI0027: Oxidoreductase, GMC family
 
Mesorhizobium loti MAFF303099

Gene: mlr3058: Oxidoreductase, GMC family
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01728: Oxidoreductase, GMC family
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1829: Oxidoreductase, GMC family
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Oxidoreductase, GMC family
Atu0777
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mlr3059: hypothetical protein
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
hypothetical protein
RHE_CH01729
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01729: putative oxidoreductase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1830: putative oxidoreductase
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
putative oxidoreductase
RHE_CH01730
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01730: putative oxidoreductase protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1831: putative oxidoreductase protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
putative oxidoreductase protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD