Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog KglR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222 7 1
Rhodobacter sphaeroides 2.4.1
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Sma0079
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -52
score = 6.36089
sequence = GATTTAGATCGTTCTAAATC

Gene: Pden_5079: amino acid ABC transporter, inner membrane protein
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
amino acid ABC transporter, inner membrane protein
Sma0081
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_5080: amino acid ABC transporter, inner membrane protein
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
amino acid ABC transporter, inner membrane protein
Sma0082
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_5081: amino acid ABC transporter, substrate-binding protein
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
amino acid ABC transporter, substrate-binding protein
Sma0083
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_5082: amino acid ABC transporter, ATP-binding protein
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
amino acid ABC transporter, ATP-binding protein
PF00389
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_5083: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
Pden_5084
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_5084: sugar kinase, PfkB family
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
sugar kinase, PfkB family
COG3971
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_5085: 2-keto-4-pentenoate hydratase
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
2-keto-4-pentenoate hydratase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD