Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Jann_1107 - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1 18 4
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516 10 1
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Jann_2640
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -86
score = 6.61837
sequence = TTTTGCAAACCTATGCAAAA

Gene: Jann_2640: Sugar ABC transporter, ATP-binding protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
*
Oceanicola granulosus HTCC2516

Site:
position = -50
score = 4.95742
sequence = CCTTGCAAGCGCATGCAAGG

Gene: OG2516_10551: Sugar ABC transporter, ATP-binding protein
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, ATP-binding protein
Jann_3701
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -36
score = 6.36128
sequence = TCTTGCAAACCTATGCAAAA

Gene: Jann_3701: Sugar ABC transporter, substrate-binding protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10546: Sugar ABC transporter, substrate-binding protein
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, substrate-binding protein
Jann_3700
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_3700: Sugar ABC transporter, inner membrane protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10541: Sugar ABC transporter, inner membrane protein
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, inner membrane protein
Jann_3699
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_3699: Sugar ABC transporter, inner membrane protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10536: Sugar ABC transporter, inner membrane protein
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, inner membrane protein
PF03766
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_2638: Protein of unknown function DUF1486
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10531: Protein of unknown function DUF1486
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Protein of unknown function DUF1486
PF00815
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -81
score = 5.9338
sequence = TTTTGCAATCGTATGCAGAT

Gene: Jann_1104: Histidinol dehydrogenase
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10526: Histidinol dehydrogenase
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Histidinol dehydrogenase
PF07366-3
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1105: Protein of unknown function DUF1486
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10521: Protein of unknown function DUF1486
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Protein of unknown function DUF1486
COG1028
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1106: short-chain dehydrogenase/reductase SDR
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10516: short-chain dehydrogenase/reductase SDR
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
short-chain dehydrogenase/reductase SDR
Jann_1107
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1107: Transcriptional regulator, LacI family
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10511: Transcriptional regulator, LacI family
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Transcriptional regulator, LacI family
PF07366-2
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1108: Protein of unknown function DUF1486
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10506: Protein of unknown function DUF1486
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Protein of unknown function DUF1486
Jann_4090
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -93
score = 5.72872
sequence = GGGTGCATACGAATGCAAAA

Gene: Jann_4090: Sugar ABC transporter, substrate-binding protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, substrate-binding protein
Jann_4089
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_4089: Sugar ABC transporter, inner membrane protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, inner membrane protein
Jann_4088
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_4088: Sugar ABC transporter, inner membrane protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, inner membrane protein
Jann_4087
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_4087: Sugar ABC transporter, ATP-binding protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, ATP-binding protein
Jann_4086
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_4086: hypothetical protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
hypothetical protein
Jann_4085
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_4085: Cupin 2 protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Cupin 2 protein
Jann_4084
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_4084: acyl transferase
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
acyl transferase
Jann_2639
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_2639: hypothetical protein
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD