Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IolR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1 14 4
Loktanella vestfoldensis SKA53 13 4
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040 12 4
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iolD
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -97
score = 6.93065
sequence = TGTTGCAACCGCTTGCAAAA

Gene: Jann_1420: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
*
Loktanella vestfoldensis SKA53

Site:
position = -84
score = 6.94521
sequence = GGTTGCAACCGGTTGCAAAA

Gene: SKA53_08801: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
*
Silicibacter TM1040

Site:
position = -96
score = 7.12472
sequence = GTTTGCAACCGGTTGCAAAA

Gene: TM1040_3348: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
iolC
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1419: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08796: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3349: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
5-keto-2-deoxygluconokinase (EC 2.7.1.92)
iolB
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1418: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08791: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3350: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
5-deoxy-glucuronate isomerase (EC 5.3.1.-)
iolJ
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1417: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08786: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3351: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
iolG
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1416: Myo-inositol 2-dehydrogenase EC=1.1.1.18
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08781: Myo-inositol 2-dehydrogenase EC=1.1.1.18
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3352: Myo-inositol 2-dehydrogenase EC=1.1.1.18
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Myo-inositol 2-dehydrogenase EC=1.1.1.18
 
CRON 2.
Jann_1421
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -44
score = 6.93065
sequence = TTTTGCAAGCGGTTGCAACA

Gene: Jann_1421: oxidoreductase
*
Loktanella vestfoldensis SKA53

Site:
position = -46
score = 6.94521
sequence = TTTTGCAACCGGTTGCAACC

Gene: SKA53_08806: oxidoreductase
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
*
Silicibacter TM1040

Site:
position = -47
score = 7.12472
sequence = TTTTGCAACCGGTTGCAAAC

Gene: TM1040_3347: oxidoreductase
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
oxidoreductase
iolE
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1422: myo-inositol catabolism protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08811: myo-inositol catabolism protein
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3346: myo-inositol catabolism protein
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
myo-inositol catabolism protein
Jann_1423
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1423: oxidoreductase
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08816: oxidoreductase
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3345: oxidoreductase
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
oxidoreductase
 
CRON 3.
iolR
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -95
score = 7.44503
sequence = TTTTGCAACCGGTTGCAAAA

Gene: Jann_1424: Transcriptional regulator of inositol utilization, LacI famil
*
Loktanella vestfoldensis SKA53

Site:
position = -95
score = 6.73742
sequence = AATTGCAACCGGTTGCAAAA

Gene: SKA53_08821: Transcriptional regulator of inositol utilization, LacI famil
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
*
Silicibacter TM1040

Site:
position = -100
score = 7.12472
sequence = CTTTGCAACCGGTTGCAAAA

Gene: TM1040_3344: Transcriptional regulator of inositol utilization, LacI famil
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Transcriptional regulator of inositol utilization, LacI famil
 
CRON 4.
iolK
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -126
score = 7.44503
sequence = TTTTGCAACCGGTTGCAAAA

Gene: Jann_1425: Sugar ABC transporter, substrate-binding protein
*
Loktanella vestfoldensis SKA53

Site:
position = -111
score = 6.73742
sequence = TTTTGCAACCGGTTGCAATT

Gene: SKA53_08826: Sugar ABC transporter, substrate-binding protein
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
*
Silicibacter TM1040

Site:
position = -216
score = 4.94237
sequence = TTCTGCAACCTCTTTCAACG

Site:
position = -106
score = 7.12472
sequence = TTTTGCAACCGGTTGCAAAG

Gene: TM1040_3343: Sugar ABC transporter, substrate-binding protein
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, substrate-binding protein
iolL
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1426: Sugar ABC transporter, inner membrane protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08831: Sugar ABC transporter, inner membrane protein
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3342: Sugar ABC transporter, inner membrane protein
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, inner membrane protein
iolM
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1427: Sugar ABC transporter, ATP-binding protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08836: Sugar ABC transporter, ATP-binding protein
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3341: Sugar ABC transporter, ATP-binding protein
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Sugar ABC transporter, ATP-binding protein
Jann_1428
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1428: Phytanoyl-CoA dioxygenase
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Phytanoyl-CoA dioxygenase
iolB
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_1429: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08841: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD