Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GabR - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Gamma-aminobutyrate utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975 9 5
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314
Corynebacterium glutamicum ATCC 13032 4 2
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gabT2
 
Corynebacterium amycolatum SK46
*2
Corynebacterium aurimucosum ATCC 700975

Site:
position = -207
score = 5.20225
sequence = ATCGTGCAGAATTTCTATCCCCA

Site:
position = -113
score = 5.53957
sequence = ATTGTGGACAATTTCTCACCATT

Gene: cauri_0643: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)

Site:
position = -96
score = 5.36301
sequence = TAGGTGCAAAATTTATACACCCT

Gene: cauri_0646: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -113
score = 4.86861
sequence = ATGGGCGAAATATTGTCTACAAC

Gene: cg0566: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
gabD2
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0315: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0833: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0567: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
 
Corynebacterium jeikeium K411

Gene: jk0450: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1509: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
gabP
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0647: Predicted amino acids permease
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0568: Predicted amino acids permease
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted amino acids permease
hapE
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0642: 4-hydroxyacetophenone monooxygenase (EC 1.14.13.84)
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
4-hydroxyacetophenone monooxygenase (EC 1.14.13.84)
lipN
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0641: Putative lipase/esterase
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Putative lipase/esterase
 
CRON 2.
gabD1
 
Corynebacterium amycolatum SK46
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -45
score = 4.04044
sequence = ATGGGGTGCAACCCATACACACT

Gene: cauri_0649: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
cauri_0648
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_0648: Hypothetical protein
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Hypothetical protein
 
CRON 3.
gabR
 
Corynebacterium amycolatum SK46
*2
Corynebacterium aurimucosum ATCC 700975

Site:
position = -44
score = 5.20225
sequence = TGGGGATAGAAATTCTGCACGAT

Site:
position = -138
score = 5.53957
sequence = AATGGTGAGAAATTGTCCACAAT

Gene: cauri_0644: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family

Site:
position = -44
score = 5.36301
sequence = AGGGTGTATAAATTTTGCACCTA

Gene: cauri_0645: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -50
score = 4.86861
sequence = GTTGTAGACAATATTTCGCCCAT

Gene: cg0565: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD