Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CscR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895
Edwardsiella tarda EIB202
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 2
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320 2 2
Salmonella typhimurium LT2
Serratia proteamaculans 568 2 1
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cscR
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -136
score = 6.37612
sequence = AAAAGTTAACGTTAACATAA

Site:
position = -200
score = 5.44952
sequence = TTATGGTAACGTTAACAAAA

Gene: KPN_03263: Sucrose utilization transcriptional regulator, LacI family
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320

Gene: PMI2191: Sucrose utilization transcriptional regulator, LacI family
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_2081: Sucrose utilization transcriptional regulator, LacI family
 
Yersinia pestis KIM
Sucrose utilization transcriptional regulator, LacI family
 
CRON 2.
cscB
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -110
score = 6.37612
sequence = TTATGTTAACGTTAACTTTT

Site:
position = -46
score = 5.44952
sequence = TTTTGTTAACGTTACCATAA

Gene: KPN_03262: Sucrose permease, major facilitator superfamily
 
Photorhabdus luminescens subsp. laumondii TTO1
*
Proteus mirabilis HI4320

Site:
position = -116
score = 6.37612
sequence = ATATGTTAACGTTAACTTTA

Site:
position = -53
score = 5.87576
sequence = TAGAGTTAACGTTAACATTC

Gene: PMI0850: Sucrose permease, major facilitator superfamily
 
Salmonella typhimurium LT2
*
Serratia proteamaculans 568

Site:
position = -114
score = 6.79899
sequence = AAATGTTAACGTTAACTTTT

Site:
position = -50
score = 6.3467
sequence = TAAAGTTAACGTTAACAATA

Gene: Spro_2083: Sucrose permease, major facilitator superfamily
 
Yersinia pestis KIM
Sucrose permease, major facilitator superfamily
cscA
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03261: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Photorhabdus luminescens subsp. laumondii TTO1
*
Proteus mirabilis HI4320

Site:
position = -133
score = 4.90281
sequence = TCCTGATAACGTTAACATAA

Site:
position = -65
score = 4.62968
sequence = AAATGTTATCGCTAATAAGG

Gene: PMI2190: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_2082: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Yersinia pestis KIM
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD