Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895
Edwardsiella tarda EIB202
Enterobacter sp. 638 3 1
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043 4 1
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 1
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
celC
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
*
Enterobacter sp. 638

Site:
position = -72
score = 6.08815
sequence = ATTTTTGGTATGCCAATAGT

Site:
position = -166
score = 5.26594
sequence = GTAAGTGGTATGCCAAAGTG

Gene: Ent638_3282: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -111
score = 5.77137
sequence = ATTTTTGGTATGCCAAACGC

Site:
position = -175
score = 5.57054
sequence = CATATTGGAATTCCAATATT

Site:
position = -206
score = 5.72045
sequence = GCTTATGGTATGCCAAAAAT

Gene: ECA3647: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Escherichia coli str. K-12 substr. MG1655
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -136
score = 5.04623
sequence = ATATTTGGGATACCACTGTG

Site:
position = -167
score = 5.3947
sequence = GACTCTGGTATGCCAATGTC

Site:
position = -72
score = 5.62678
sequence = TGTTTTGGTATGCCAAAAGT

Gene: KPN_03250: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
celH
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_3281: Beta-glucosidase (EC 3.2.1.21)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3646: Beta-glucosidase (EC 3.2.1.21)
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03249: Beta-glucosidase (EC 3.2.1.21)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Beta-glucosidase (EC 3.2.1.21)
celB
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3645: PTS system, cellobiose-specific IIB component
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
PTS system, cellobiose-specific IIB component
celR
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_3280: Predicted cellobiose utilization transcriptional repressor, GntR family
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3644: Predicted cellobiose utilization transcriptional repressor, GntR family
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03248: Predicted cellobiose utilization transcriptional repressor, GntR family
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Predicted cellobiose utilization transcriptional repressor, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD