Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog QorR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 2 2
Edwardsiella tarda EIB202
Enterobacter sp. 638 2 2
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043 2 2
Escherichia coli str. K-12 substr. MG1655 2 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 2 2
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320 2 2
Salmonella typhimurium LT2 2 2
Serratia proteamaculans 568
Yersinia pestis KIM 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
qorR
*
Citrobacter koseri ATCC BAA-895

Site:
position = -43
score = 6.59987
sequence = AAACTTACTTTTAGTAAGTAC

Gene: CKO_03617: Redox-sensing transcriptional regulator QorR, HxlR family
 
Edwardsiella tarda EIB202
*
Enterobacter sp. 638

Site:
position = -37
score = 6.28035
sequence = TAACTAACTTATAGTAAGTAC

Gene: Ent638_0384: Redox-sensing transcriptional regulator QorR, HxlR family
 
Erwinia amylovora ATCC 49946
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -40
score = 6.12513
sequence = AAGCTAACTTTAAGTAAGTAC

Gene: ECA4450: Redox-sensing transcriptional regulator QorR, HxlR family
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -42
score = 6.59987
sequence = AAACTTACTTTTAGTAAGTAC

Gene: b4212: Redox-sensing transcriptional regulator QorR, HxlR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -42
score = 6.28035
sequence = TAACTAACTTTTAGTAAGTAC

Gene: KPN_04606: Redox-sensing transcriptional regulator QorR, HxlR family
 
Photorhabdus luminescens subsp. laumondii TTO1
*
Proteus mirabilis HI4320

Site:
position = -42
score = 6.59987
sequence = AAACTTACTAAAAGTAAGTAC

Gene: PMI0975: Redox-sensing transcriptional regulator QorR, HxlR family
*
Salmonella typhimurium LT2

Site:
position = -41
score = 6.59987
sequence = AAACTTACTTTTAGTAAGTAC

Gene: STM4402: Redox-sensing transcriptional regulator QorR, HxlR family
 
Serratia proteamaculans 568
 
Yersinia pestis KIM

Gene: y1807: Redox-sensing transcriptional regulator QorR, HxlR family
Redox-sensing transcriptional regulator QorR, HxlR family
 
CRON 2.
qorB
*
Citrobacter koseri ATCC BAA-895

Site:
position = -34
score = 6.59987
sequence = GTACTTACTAAAAGTAAGTTT

Gene: CKO_03618: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Edwardsiella tarda EIB202
*
Enterobacter sp. 638

Site:
position = -67
score = 6.28035
sequence = GTACTTACTATAAGTTAGTTA

Gene: Ent638_0383: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Erwinia amylovora ATCC 49946
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -81
score = 6.12513
sequence = GTACTTACTTAAAGTTAGCTT

Gene: ECA4449: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -67
score = 6.59987
sequence = GTACTTACTAAAAGTAAGTTT

Gene: b4211: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -68
score = 6.28035
sequence = GTACTTACTAAAAGTTAGTTA

Gene: KPN_04605: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Photorhabdus luminescens subsp. laumondii TTO1
*
Proteus mirabilis HI4320

Site:
position = -68
score = 6.59987
sequence = GTACTTACTTTTAGTAAGTTT

Gene: PMI0976: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
*
Salmonella typhimurium LT2

Site:
position = -67
score = 6.59987
sequence = GTACTTACTAAAAGTAAGTTT

Gene: STM4401: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Serratia proteamaculans 568
*
Yersinia pestis KIM

Site:
position = -119
score = 5.8773
sequence = GTACTTACGTAAAGTGAGTAT

Gene: y1806: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD