Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Arth_2426 - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1
Arthrobacter chlorophenolicus A6 5 2
Arthrobacter sp. FB24 5 2
Beutenbergia cavernae DSM 12333 3 1
Brachybacterium faecium DSM 4810 3 1
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649 7 2
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Arth_2426
 
Arthrobacter aurescens TC1

Gene: AAur_3699: Sugar utilization transctriptional regulator, LacI family
*
Arthrobacter chlorophenolicus A6

Site:
position = -128
score = 6.24395
sequence = TTGGGAAAGCGCATTCCCAC

Site:
position = -79
score = 5.89967
sequence = GTTGGCAAGCGCTTTCCGGA

Gene: Achl_2180: Sugar utilization transctriptional regulator, LacI family
*
Arthrobacter sp. FB24

Site:
position = -81
score = 5.74855
sequence = CATGGCAAGCGCTTTCCCGA

Site:
position = -129
score = 6.13504
sequence = CTGGGAAAGCGCATTCCCAC

Gene: Arth_2426: Sugar utilization transctriptional regulator, LacI family
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_3360: Sugar utilization transctriptional regulator, LacI family
 
Brachybacterium faecium DSM 4810

Gene: Bfae_28980: Sugar utilization transctriptional regulator, LacI family
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
*
Janibacter sp. HTCC2649

Site:
position = -137
score = 5.39524
sequence = TGCGGAGAGCGCTTTCCGCT

Gene: JNB_06194: Sugar utilization transctriptional regulator, LacI family
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Sugar utilization transctriptional regulator, LacI family
AAur_3697
 
Arthrobacter aurescens TC1

Gene: AAur_3697: putative lipase/esterase
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2181: putative lipase/esterase
 
Arthrobacter sp. FB24

Gene: Arth_2427: endo-1,4-beta-xylanase B
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
putative lipase/esterase
 
CRON 2.
JNB_06199
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
*
Janibacter sp. HTCC2649

Site:
position = -61
score = 5.39524
sequence = AGCGGAAAGCGCTCTCCGCA

Gene: JNB_06199: Hydroxymethylpyrimidine ABC transporter, transmembrane component
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Hydroxymethylpyrimidine ABC transporter, transmembrane component
JNB_06204
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_06204: Hydroxymethylpyrimidine ABC transporter, substrate-binding component
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Hydroxymethylpyrimidine ABC transporter, substrate-binding component
JNB_06209
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_06209: Hydroxymethylpyrimidine ABC transporter, ATPase component
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Hydroxymethylpyrimidine ABC transporter, ATPase component
SCO2752
 
Arthrobacter aurescens TC1
*
Arthrobacter chlorophenolicus A6

Site:
position = -110
score = 5.89967
sequence = TCCGGAAAGCGCTTGCCAAC

Site:
position = -61
score = 6.24395
sequence = GTGGGAATGCGCTTTCCCAA

Gene: Achl_2179: Predicted glucose-fructose oxidoreductase
*
Arthrobacter sp. FB24

Site:
position = -55
score = 6.13504
sequence = GTGGGAATGCGCTTTCCCAG

Site:
position = -103
score = 5.74855
sequence = TCGGGAAAGCGCTTGCCATG

Gene: Arth_2425: Predicted glucose-fructose oxidoreductase
*
Beutenbergia cavernae DSM 12333

Site:
position = -31
score = 5.84884
sequence = GCCGGAAAGCGCATTCCCTA

Gene: Bcav_3365: Predicted glucose-fructose oxidoreductase
*
Brachybacterium faecium DSM 4810

Site:
position = -116
score = 5.50025
sequence = CTGGACAAGCGCTTGCCCGA

Gene: Bfae_29090: Predicted glucose-fructose oxidoreductase
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_06214: Predicted glucose-fructose oxidoreductase
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted glucose-fructose oxidoreductase
SCO2751
 
Arthrobacter aurescens TC1

Gene: AAur_3700: Conserved hypothetical protein, potentially related to sugar utilization
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2178: Conserved hypothetical protein, potentially related to sugar utilization
 
Arthrobacter sp. FB24

Gene: Arth_2424: Conserved hypothetical protein, potentially related to sugar utilization
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_3366: Conserved hypothetical protein, potentially related to sugar utilization
 
Brachybacterium faecium DSM 4810

Gene: Bfae_29080: Conserved hypothetical protein, potentially related to sugar utilization
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_06219: Conserved hypothetical protein, potentially related to sugar utilization
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Conserved hypothetical protein, potentially related to sugar utilization
SCO2750
 
Arthrobacter aurescens TC1

Gene: AAur_3701: Predicted sugar phosphate isomerases/epimerase
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2177: Predicted sugar phosphate isomerases/epimerase
 
Arthrobacter sp. FB24

Gene: Arth_2423: Predicted sugar phosphate isomerases/epimerase
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_3367: Predicted sugar phosphate isomerases/epimerase
 
Brachybacterium faecium DSM 4810

Gene: Bfae_29070: Predicted sugar phosphate isomerases/epimerase
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_06224: Predicted sugar phosphate isomerases/epimerase
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted sugar phosphate isomerases/epimerase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD