Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AlsR - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Allose utilization
Effector: Allose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262
Listeria monocytogenes EGD-e 6 2
Listeria seeligeri serovar 1/2b str. SLCC3954
Listeria welshimeri serovar 6b str. SLCC5334 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
alsR
 
Listeria innocua Clip11262
*
Listeria monocytogenes EGD-e

Site:
position = -34
score = 5.28269
sequence = AAATAAAAACGTTTACTCAT

Site:
position = -153
score = 5.47704
sequence = ATGAGTAATCGTTTTACCTT

Site:
position = -198
score = 5.62884
sequence = TTGAGATAACGATTACTCAT

Gene: lmo0734: Transcriptional regulator of D-allose utilization, LacI family
 
Listeria seeligeri serovar 1/2b str. SLCC3954
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -151
score = 5.25751
sequence = ACGGGTAATCGTTTTACCAT

Site:
position = -197
score = 5.62884
sequence = TTGAGATAACGATTACTCAT

Site:
position = -34
score = 5.39298
sequence = ATATATAAACGTTTACTCAA

Gene: lwe0703: Transcriptional regulator of D-allose utilization, LacI family
Transcriptional regulator of D-allose utilization, LacI family
 
CRON 2.
alsE
 
Listeria innocua Clip11262
*
Listeria monocytogenes EGD-e

Site:
position = -80
score = 5.47704
sequence = AAGGTAAAACGATTACTCAT

Site:
position = -35
score = 5.62884
sequence = ATGAGTAATCGTTATCTCAA

Site:
position = -199
score = 5.28269
sequence = ATGAGTAAACGTTTTTATTT

Gene: lmo0735: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
 
Listeria seeligeri serovar 1/2b str. SLCC3954
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -200
score = 5.39298
sequence = TTGAGTAAACGTTTATATAT

Site:
position = -37
score = 5.62884
sequence = ATGAGTAATCGTTATCTCAA

Site:
position = -83
score = 5.25751
sequence = ATGGTAAAACGATTACCCGT

Gene: lwe0704: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
alsI
 
Listeria innocua Clip11262
 
Listeria monocytogenes EGD-e

Gene: lmo0736: D-allose-6-phosphate isomerase (EC 5.3.1.-)
 
Listeria seeligeri serovar 1/2b str. SLCC3954
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0705: D-allose-6-phosphate isomerase (EC 5.3.1.-)
D-allose-6-phosphate isomerase (EC 5.3.1.-)
lmo0737
 
Listeria innocua Clip11262
 
Listeria monocytogenes EGD-e

Gene: lmo0737: hypothetical protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954
 
Listeria welshimeri serovar 6b str. SLCC5334
hypothetical protein
alsB
 
Listeria innocua Clip11262
 
Listeria monocytogenes EGD-e

Gene: lmo0738: PTS system, D-allose-specific IIB component (EC 2.7.1.69) / PTS system, D-allose-specific IIC component (EC 2.7.1.69) / PTS system, D-allose-specific IIA component (EC 2.7.1.69)
 
Listeria seeligeri serovar 1/2b str. SLCC3954
 
Listeria welshimeri serovar 6b str. SLCC5334
PTS system, D-allose-specific IIB component (EC 2.7.1.69) / PTS system, D-allose-specific IIC component (EC 2.7.1.69) / PTS system, D-allose-specific IIA component (EC 2.7.1.69)
bglH
 
Listeria innocua Clip11262
 
Listeria monocytogenes EGD-e

Gene: lmo0739: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Listeria seeligeri serovar 1/2b str. SLCC3954
 
Listeria welshimeri serovar 6b str. SLCC5334
6-phospho-beta-glucosidase (EC 3.2.1.86)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD