Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BH1516 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16 3 1
Bacillus halodurans C-125 3 3
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BH1516
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3478: Putative maltose catabolism transcriptional regulator, LacI family
*
Bacillus halodurans C-125

Site:
position = -34
score = 5.96819
sequence = CACAGAAAACGTTTTCGTTT

Gene: BH1516: Putative maltose catabolism transcriptional regulator, LacI family
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5046: Putative maltose catabolism transcriptional regulator, LacI family
Putative maltose catabolism transcriptional regulator, LacI family
 
CRON 2.
msmE
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = 35
score = 6.25033
sequence = TAACGTAAACGTTTACTATA

Site:
position = 4
score = 5.60251
sequence = ATACGAAAACGTTTACTCCC

Gene: ABC3496: Multiple sugar ABC transporter, substrate-binding protein
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Multiple sugar ABC transporter, substrate-binding protein
msmF
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3497: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
msmG
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3498: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Multiple sugar ABC transporter, membrane-spanning permease protein MsmG
 
CRON 3.
malL
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2271: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC4015: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus clausii KSM-K16
*
Bacillus halodurans C-125

Site:
position = -113
score = 5.87109
sequence = TCACGTAAACGTTTTCTCTC

Site:
position = -32
score = 6.34609
sequence = TTACGTAAACGTTTTCGTTA

Gene: BH2903: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Oligo-1,6-glucosidase (EC 3.2.1.10)
 
CRON 4.
amyA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC1611: Alpha-amylase protein
*
Bacillus halodurans C-125

Site:
position = -104
score = 6.50111
sequence = AAAAGTAAACGTTTTCTTTT

Gene: BH0413: Alpha-amylase protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alpha-amylase protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD