Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR2 - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 4 4
Listeria monocytogenes EGD-e 4 4
Listeria seeligeri serovar 1/2b str. SLCC3954 4 4
Listeria welshimeri serovar 6b str. SLCC5334 4 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglH1
*
Listeria innocua Clip11262

Site:
position = -68
score = 6.62682
sequence = CTATGTAATGCATTACATAT

Gene: lin0017: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
*
Listeria monocytogenes EGD-e

Site:
position = -67
score = 6.62682
sequence = CTATGTAATGCATTACATAT

Gene: lmo0018: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -67
score = 6.59759
sequence = CTCTGTAATGCATTACATAT

Gene: lse_0017: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -66
score = 6.62682
sequence = CTATGTAATGCATTACATAT

Gene: lwe0018: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
 
CRON 2.
bglH2
*
Listeria innocua Clip11262

Site:
position = -66
score = 6.51822
sequence = ACCTGTAATGCATTACACAA

Gene: lin0288: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
*
Listeria monocytogenes EGD-e

Site:
position = -66
score = 6.51822
sequence = ACCTGTAATGCATTACACAA

Gene: lmo0261: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -66
score = 6.44966
sequence = ACCTGTAATGCATTACACAG

Gene: lse_0246: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -66
score = 6.66974
sequence = ACCTGTAATGCATTACATAG

Gene: lwe0230: Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
Aryl-phospho-beta-D-glucosidase (EC 3.2.1.86)
 
CRON 3.
licH
*
Listeria innocua Clip11262

Site:
position = -77
score = 6.81045
sequence = ACCTGTAATGCATTACATGA

Gene: lin0540: 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Listeria monocytogenes EGD-e

Site:
position = -77
score = 6.81045
sequence = ACCTGTAATGCATTACATGA

Gene: lmo0536: 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -78
score = 6.81045
sequence = ACCTGTAATGCATTACATGA

Gene: lse_0449: 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -77
score = 6.81045
sequence = ACCTGTAATGCATTACATGA

Gene: lwe0496: 6-phospho-beta-glucosidase (EC 3.2.1.86)
6-phospho-beta-glucosidase (EC 3.2.1.86)
 
CRON 4.
bglR2
*
Listeria innocua Clip11262

Site:
position = -114
score = 6.81045
sequence = TCATGTAATGCATTACAGGT

Gene: lin0539: Transcriptional regulator for beta-glucoside utilization, LacI family
*
Listeria monocytogenes EGD-e

Site:
position = -114
score = 6.81045
sequence = TCATGTAATGCATTACAGGT

Gene: lmo0535: Transcriptional regulator for beta-glucoside utilization, LacI family
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -114
score = 6.81045
sequence = TCATGTAATGCATTACAGGT

Gene: lse_0448: Transcriptional regulator for beta-glucoside utilization, LacI family
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -114
score = 6.81045
sequence = TCATGTAATGCATTACAGGT

Gene: lwe0495: Transcriptional regulator for beta-glucoside utilization, LacI family
Transcriptional regulator for beta-glucoside utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD