Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Cellobiose utilization
Effector: Cellobiose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 5 1
Arthrobacter chlorophenolicus A6 5 1
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333 5 1
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603 5 1
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cebE
*
Arthrobacter aurescens TC1

Site:
position = -59
score = 4.93141
sequence = CTCAGAGAGCGCTCTCTCGC

Site:
position = -115
score = 4.64947
sequence = GTCAGAGAGCGCTCTCTTGA

Gene: AAur_0088: Cellobiose specific ABC transporter, substrate-binding protein
*
Arthrobacter chlorophenolicus A6

Site:
position = -115
score = 6.03332
sequence = TGGTGAGAGCGCTCCCATGA

Site:
position = -170
score = 4.86772
sequence = CGATGGGAGCGCTCCTAAAT

Site:
position = -226
score = 5.89913
sequence = TGGTGGGAGCGCTCCCGTCG

Gene: Achl_0399: Cellobiose specific ABC transporter, substrate-binding protein
 
Arthrobacter sp. FB24
*
Beutenbergia cavernae DSM 12333

Site:
position = -132
score = 6.14418
sequence = CCGTGAGAGCGCTCCCATGG

Site:
position = -96
score = 5.96195
sequence = CCTTGGGAGCGCTCTCACCA

Gene: Bcav_2837: Cellobiose specific ABC transporter, substrate-binding protein
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0086: Cellobiose specific ABC transporter, substrate-binding protein
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -340
score = 6.08425
sequence = CGGTGGGAACGTTCCCACCG

Site:
position = -158
score = 5.33225
sequence = AGGTGGAAACGCTCCCACGC

Site:
position = -124
score = 5.60155
sequence = CGGTGGGAGCGCTACCAGAA

Gene: Jden_1882: Cellobiose specific ABC transporter, substrate-binding protein
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Cellobiose specific ABC transporter, substrate-binding protein
cebF
 
Arthrobacter aurescens TC1

Gene: AAur_0087: Cellobiose specific ABC transporter, permease protein 1
 
Arthrobacter chlorophenolicus A6

Gene: Achl_0400: Cellobiose specific ABC transporter, permease protein 1
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2838: Cellobiose specific ABC transporter, permease protein 1
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0085: Cellobiose specific ABC transporter, permease protein 1
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_1881: Cellobiose specific ABC transporter, permease protein 1
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Cellobiose specific ABC transporter, permease protein 1
cebG
 
Arthrobacter aurescens TC1

Gene: AAur_0086: Cellobiose specific ABC transporter, permease protein 2
 
Arthrobacter chlorophenolicus A6

Gene: Achl_0401: Cellobiose specific ABC transporter, permease protein 2
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2839: Cellobiose specific ABC transporter, permease protein 2
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0084: Cellobiose specific ABC transporter, permease protein 2
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_1880: Cellobiose specific ABC transporter, permease protein 2
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Cellobiose specific ABC transporter, permease protein 2
bglC
 
Arthrobacter aurescens TC1

Gene: AAur_0085: Beta-glucosidase (EC 3.2.1.21)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_0402: Beta-glucosidase (EC 3.2.1.21)
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2840: Beta-glucosidase (EC 3.2.1.21)
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_1879: Beta-glucosidase (EC 3.2.1.21)
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Beta-glucosidase (EC 3.2.1.21)
celR
 
Arthrobacter aurescens TC1

Gene: AAur_0084: Cellobiose utilization transcriptional regulator CelR, LacI family
 
Arthrobacter chlorophenolicus A6

Gene: Achl_0403: Cellobiose utilization transcriptional regulator CelR, LacI family
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2841: Cellobiose utilization transcriptional regulator CelR, LacI family
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_1878: Cellobiose utilization transcriptional regulator CelR, LacI family
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Cellobiose utilization transcriptional regulator CelR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD