Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Caur_3587 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process:
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 2 2
Chloroflexus sp. Y-400-fl 4 2
Herpetosiphon aurantiacus ATCC 23779 5 2
Roseiflexus castenholzii DSM 13941 3 2
Roseiflexus sp. RS-1 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Caur_3587
*
Chloroflexus aggregans DSM 9485

Site:
position = -59
score = 6.54058
sequence = ATATTGACAATTGTCAATAT

Gene: Cagg_0492: transcriptional regulator, ArsR family
*
Chloroflexus sp. Y-400-fl

Site:
position = -60
score = 6.60038
sequence = ATATTGACAATCTTCAATAT

Gene: Chy400_3868: transcriptional regulator, ArsR family
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -50
score = 5.53072
sequence = ATATTGAATTAATTCGATAA

Gene: Haur_0112: transcriptional regulator, ArsR family
*
Roseiflexus castenholzii DSM 13941

Site:
position = -52
score = 6.60038
sequence = ATATTGACAATCTTCAATAT

Gene: Rcas_2310: transcriptional regulator, ArsR family
*
Roseiflexus sp. RS-1

Site:
position = -22
score = 6.46969
sequence = ATATTGACATTCTTCAATAT

Gene: RoseRS_1223: transcriptional regulator, ArsR family
transcriptional regulator, ArsR family
PF0583
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0263: GCN5-related N-acetyltransferase (GNAT) domain
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_3609: GCN5-related N-acetyltransferase (GNAT) domain
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0111: GCN5-related N-acetyltransferase (GNAT) domain
*
Roseiflexus castenholzii DSM 13941

Site:
position = -252
score = 5.57405
sequence = ATATCGATGATCATCAATAC

Gene: Rcas_2311: GCN5-related N-acetyltransferase (GNAT) domain
 
Roseiflexus sp. RS-1
GCN5-related N-acetyltransferase (GNAT) domain
ubiE
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0110: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_2312: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
*
Roseiflexus sp. RS-1

Site:
position = -71
score = 6.52318
sequence = ATATTGATGATCTTCAATAT

Gene: RoseRS_1224: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
SAM-dependent methyltransferase DSY4148 (UbiE paralog)
 
CRON 2.
PF07992
*
Chloroflexus aggregans DSM 9485

Site:
position = -89
score = 5.87957
sequence = TTATTGATGTATGTCAATAT

Gene: Cagg_0491: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
*
Chloroflexus sp. Y-400-fl

Site:
position = -43
score = 6.00201
sequence = ATATCGATGATCTTCGATAT

Gene: Chy400_3867: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -188
score = 5.86784
sequence = ATATTGATTTTTTTCAATCT

Site:
position = -41
score = 6.29615
sequence = ATATTGAAAATTTTCAATTT

Gene: Haur_2824: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
MFS
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_3866: transporter, major facilitator superfamily (MFS)
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_2823: transporter, major facilitator superfamily (MFS)
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
transporter, major facilitator superfamily (MFS)
PF07992
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0199: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_3865: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0689: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD