Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Caur_3401 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 3 1
Chloroflexus sp. Y-400-fl 2 1
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941 2 1
Roseiflexus sp. RS-1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acrB
*
Chloroflexus aggregans DSM 9485

Site:
position = -69
score = 7.02989
sequence = ACTTTACGGTATAGTAAAAA

Gene: Cagg_0354: Probable multidrug efflux system from RND family, AcrB pore domain
*
Chloroflexus sp. Y-400-fl

Site:
position = -69
score = 7.02989
sequence = ACTTTACGGTATAGTAAAAA

Gene: Chy400_3664: Probable multidrug efflux system from RND family, AcrB pore domain
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus castenholzii DSM 13941

Site:
position = -156
score = 6.61776
sequence = ATTTTACTGTATAGTAGTCT

Gene: Rcas_4170: Probable multidrug efflux system from RND family, AcrB pore domain
*
Roseiflexus sp. RS-1

Site:
position = -136
score = 6.61776
sequence = ATTTTACTGTATAGTAGTCT

Gene: RoseRS_4303: Probable multidrug efflux system from RND family, AcrB pore domain
Probable multidrug efflux system from RND family, AcrB pore domain
hlyD
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0355: secretion protein HlyD family protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_3663: secretion protein HlyD family protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4169: secretion protein HlyD family protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_4302: secretion protein HlyD family protein
secretion protein HlyD family protein
Caur_3401
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0356: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4171: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
 
Roseiflexus sp. RS-1

Gene: RoseRS_4304: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD