Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AcrR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 6 2
Chloroflexus sp. Y-400-fl 5 2
Roseiflexus castenholzii DSM 13941 5 2
Roseiflexus sp. RS-1 4 1
Herpetosiphon aurantiacus ATCC 23779
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acrR
*2
Chloroflexus aggregans DSM 9485

Gene: Cagg_0421: Predicted transcriptional regulator of multidrug efflux transporter, TetR family

Site:
position = -44
score = 6.93479
sequence = ATTACTTACCGGTCGGTAAGAATT

Gene: Cagg_2437: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
*2
Chloroflexus sp. Y-400-fl

Site:
position = -48
score = 6.93479
sequence = ATTACTTACCGGTCGGTAAGAATT

Gene: Chy400_1090: Predicted transcriptional regulator of multidrug efflux transporter, TetR family

Gene: Chy400_3789: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
*
Roseiflexus castenholzii DSM 13941

Site:
position = -86
score = 6.68211
sequence = ATTCCTGACCGTTCGGTAAAGTGA

Gene: Rcas_0269: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
*
Roseiflexus sp. RS-1

Site:
position = -94
score = 6.68211
sequence = ATTCCTGACCGTTCGGTAAAGTGG

Gene: RoseRS_0266: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
 
Herpetosiphon aurantiacus ATCC 23779
Predicted transcriptional regulator of multidrug efflux transporter, TetR family
acrA
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2438: Probable multidrug efflux system from RND family, membrane fusion protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1089: Probable multidrug efflux system from RND family, membrane fusion protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0268: Probable multidrug efflux system from RND family, membrane fusion protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_0267: Probable multidrug efflux system from RND family, membrane fusion protein
 
Herpetosiphon aurantiacus ATCC 23779
Probable multidrug efflux system from RND family, membrane fusion protein
salX
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2439: ABC transporter related protein SalX
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1088: ABC transporter related protein SalX
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0267: ABC transporter related protein SalX
 
Roseiflexus sp. RS-1

Gene: RoseRS_0268: ABC transporter related protein SalX
 
Herpetosiphon aurantiacus ATCC 23779
ABC transporter related protein SalX
salY
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2440: Putative cell division protein SalY
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1087: Putative cell division protein SalY
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0266: Putative cell division protein SalY
 
Roseiflexus sp. RS-1

Gene: RoseRS_0269: Putative cell division protein SalY
 
Herpetosiphon aurantiacus ATCC 23779
Putative cell division protein SalY
Cagg_0420
*
Chloroflexus aggregans DSM 9485

Site:
position = -51
score = 6.10346
sequence = GTTACCGACCGGTCGGTCGGTTTT

Gene: Cagg_0420: Multidrug transporter, MFS superfamily
*
Chloroflexus sp. Y-400-fl

Site:
position = -54
score = 6.18194
sequence = AATACTTACCGACCGGTCGGTTGG

Gene: Chy400_3788: Multidrug transporter, MFS superfamily
*
Roseiflexus castenholzii DSM 13941

Site:
position = -41
score = 6.28301
sequence = ACTCCTTACCGACCGGTAAGGAAA

Gene: Rcas_2058: Multidrug transporter, MFS superfamily
 
Roseiflexus sp. RS-1

Gene: RoseRS_1778: Multidrug transporter, MFS superfamily
 
Herpetosiphon aurantiacus ATCC 23779
Multidrug transporter, MFS superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD