Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Caur_3866 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 14 1
Chloroflexus sp. Y-400-fl 14 1
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG3459
*
Chloroflexus aggregans DSM 9485

Site:
position = -77
score = 4.89623
sequence = AAAGTGAAACATTTCACCGA

Site:
position = 103
score = 5.98688
sequence = TTTGTGAAACGTTTCATCCA

Site:
position = -3
score = 5.88396
sequence = TTTATGAAACGTTACACTCT

Gene: Cagg_0091: Cellobiose phosphorylase
*
Chloroflexus sp. Y-400-fl

Site:
position = -88
score = 6.1064
sequence = GTAATGAAACGTTTCATACC

Site:
position = -193
score = 5.91494
sequence = CGTATGAAACGTTACACAAA

Gene: Chy400_4165: Cellobiose phosphorylase
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Cellobiose phosphorylase
Caur_3857
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0090: Putative sugar ABC transporter, solute-binding component
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4166: Putative sugar ABC transporter, solute-binding component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Putative sugar ABC transporter, solute-binding component
Caur_3858
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0089: Putative sugar ABC transporter, solute-binding component
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4167: Putative sugar ABC transporter, solute-binding component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Putative sugar ABC transporter, solute-binding component
Caur_3859
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0088: Putative sugar ABC transporter, inner membrane component
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4168: Putative sugar ABC transporter, inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Putative sugar ABC transporter, inner membrane component
Caur_3860
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0087: Putative sugar ABC transporter, inner membrane component
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4169: Putative sugar ABC transporter, inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Putative sugar ABC transporter, inner membrane component
tolB
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0086: Hypothetical six-bladed beta-propeller, TolB-like protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4170: Hypothetical six-bladed beta-propeller, TolB-like protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Hypothetical six-bladed beta-propeller, TolB-like protein
Caur_3862
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0085: hypothetical protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4171: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
hypothetical protein
Caur_3863
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0084: Putative sugar ABC transporter, inner membrane component
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4172: Putative sugar ABC transporter, inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Putative sugar ABC transporter, inner membrane component
Caur_3864
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0083: Putative sugar ABC transporter, inner membrane component
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4173: Putative sugar ABC transporter, inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Putative sugar ABC transporter, inner membrane component
COG5368
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0082: conserved hypothetical protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4174: conserved hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
conserved hypothetical protein
bglR
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0081: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4175: Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Putative beta-glucoside utilization pathway transcriptional regulator, LacI family
Caur_3867
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0080: conserved hypothetical protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4176: conserved hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
conserved hypothetical protein
GH35
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0079: glycoside hydrolase family 35
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4177: glycoside hydrolase family 35
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
glycoside hydrolase family 35
bglX
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0078: Beta-glucosidase-related glycosidase
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4178: Beta-glucosidase-related glycosidase
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Beta-glucosidase-related glycosidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD