Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BfrR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus sp. Y-400-fl 5 1
Chloroflexus aggregans DSM 9485 5 1
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1
Herpetosiphon aurantiacus ATCC 23779
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bfrR
*
Chloroflexus sp. Y-400-fl

Site:
position = -46
score = 6.17585
sequence = GTCAATGAACGACCAATCTC

Gene: Chy400_2954: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
*
Chloroflexus aggregans DSM 9485

Site:
position = -46
score = 6.3673
sequence = GTCAATGGACGACCAATCTC

Gene: Cagg_3715: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
bfrE
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2953: Fructooligosaccharides ABC transporter, substrate-binding protein
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3716: Fructooligosaccharides ABC transporter, substrate-binding protein
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Fructooligosaccharides ABC transporter, substrate-binding protein
bfrF
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2952: Fructooligosaccharides ABC transporter, permease protein 1
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3717: Fructooligosaccharides ABC transporter, permease protein 1
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Fructooligosaccharides ABC transporter, permease protein 1
bfrG
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2951: Fructooligosaccharides ABC transporter, permease protein 2
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3718: Fructooligosaccharides ABC transporter, permease protein 2
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Fructooligosaccharides ABC transporter, permease protein 2
bfrA
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2950: Beta-fructosidases (EC 3.2.1.26)
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3719: Beta-fructosidases (EC 3.2.1.26)
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Beta-fructosidases (EC 3.2.1.26)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD