Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog KojR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 6 1
Chloroflexus sp. Y-400-fl 6 1
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1
Herpetosiphon aurantiacus ATCC 23779
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
kojR
*
Chloroflexus aggregans DSM 9485

Site:
position = -90
score = 6.52755
sequence = TTAAGCGAACGTTCGCTTTT

Site:
position = -36
score = 6.48364
sequence = TAAGGCGAACGTTCGCCCTA

Gene: Cagg_2268: Predicted transcriptional regulator for kojibiose utilization, LacI family
*
Chloroflexus sp. Y-400-fl

Site:
position = -30
score = 6.53787
sequence = AAAAGCGAACGTTCGCCTAG

Site:
position = -84
score = 6.4795
sequence = CCAGGCGAACGTTCGCTTTT

Gene: Chy400_2182: Predicted transcriptional regulator for kojibiose utilization, LacI family
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Predicted transcriptional regulator for kojibiose utilization, LacI family
kojE
*
Chloroflexus aggregans DSM 9485

Site:
position = 170
score = 4.83704
sequence = AAAAGTGACCGTCCGCTTGT

Gene: Cagg_2267: Kojibiose ABC transporter, substrate-binding protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2181: Kojibiose ABC transporter, substrate-binding protein
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Kojibiose ABC transporter, substrate-binding protein
kojF
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2266: Kojibiose ABC transporter, permease protein 1
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2180: Kojibiose ABC transporter, permease protein 1
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Kojibiose ABC transporter, permease protein 1
kojG
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2265: Kojibiose ABC transporter, permease protein 2
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2179: Kojibiose ABC transporter, permease protein 2
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Kojibiose ABC transporter, permease protein 2
kojP
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2264: Kojibiose phosphorylase (EC 2.4.1.230)
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2178: Kojibiose phosphorylase (EC 2.4.1.230)
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Kojibiose phosphorylase (EC 2.4.1.230)
pgmB
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2263: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2177: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
 
Herpetosiphon aurantiacus ATCC 23779
Beta-phosphoglucomutase (EC 5.4.2.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD