Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1
Arthrobacter chlorophenolicus A6
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382 5 2
Janibacter sp. HTCC2649 6 3
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
frcB
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -131
score = 5.79954
sequence = GGATGACAACGGTGTCACGA

Site:
position = -52
score = 6.30953
sequence = ACCTGACAACGTTGTCGGGA

Gene: CMM_2842: Fructose ABC transporter, substrate-binding component FrcB
*
Janibacter sp. HTCC2649

Site:
position = -122
score = 6.38307
sequence = TCCTGACAACGATGTCACGG

Site:
position = -44
score = 6.52128
sequence = CCATGACAACGTTGTCATCG

Gene: JNB_11224: Fructose ABC transporter, substrate-binding component FrcB
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Fructose ABC transporter, substrate-binding component FrcB
frcC
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2843: Fructose ABC transporter, permease component FrcC
 
Janibacter sp. HTCC2649

Gene: JNB_11219: Fructose ABC transporter, permease component FrcC
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Fructose ABC transporter, permease component FrcC
frcA
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2844: Fructose ABC transporter, ATP-binding component FrcA
 
Janibacter sp. HTCC2649

Gene: JNB_11214: Fructose ABC transporter, ATP-binding component FrcA
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Fructose ABC transporter, ATP-binding component FrcA
 
CRON 2.
sacC
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
*2
Janibacter sp. HTCC2649

Site:
position = -34
score = 5.85655
sequence = GCATGACAACGTTGTCAACG

Gene: JNB_11239: Levanase (EC 3.2.1.65)

Gene: JNB_11234: Levanase (EC 3.2.1.65)
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Levanase (EC 3.2.1.65)
 
CRON 3.
frcR
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -81
score = 6.30953
sequence = TCCCGACAACGTTGTCAGGT

Site:
position = -2
score = 5.79954
sequence = TCGTGACACCGTTGTCATCC

Gene: CMM_2841: Probable fructose utilization transcriptional regulator, LacI-family
*
Janibacter sp. HTCC2649

Site:
position = -120
score = 6.52128
sequence = CGATGACAACGTTGTCATGG

Site:
position = -42
score = 6.38307
sequence = CCGTGACATCGTTGTCAGGA

Gene: JNB_11229: Probable fructose utilization transcriptional regulator, LacI-family
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Probable fructose utilization transcriptional regulator, LacI-family
scrK
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2840: Fructokinase (EC 2.7.1.4)
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Fructokinase (EC 2.7.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD