Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BPSL1304 - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD 6 1
Burkholderia glumae BGR1 6 1
Burkholderia mallei ATCC 23344 6 2
Burkholderia phymatum STM815 6 1
Burkholderia pseudomallei K96243 6 2
Burkholderia sp. 383 6 1
Burkholderia vietnamiensis G4 6 1
Burkholderia xenovorans LB400 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BPSL1304
*
Burkholderia cepacia AMMD

Site:
position = -29
score = 6.16663
sequence = GGTCGAAAACGTTTACATCG

Gene: Bamb_1118: Predicted sugar utilization transcriptional regulator, LacI family
*
Burkholderia glumae BGR1

Site:
position = -28
score = 5.38659
sequence = CCATGGAAACGATTACAGCG

Gene: bglu_1g10520: Predicted sugar utilization transcriptional regulator, LacI family
*
Burkholderia mallei ATCC 23344

Site:
position = -36
score = 6.00298
sequence = CGACGAAAACGTTTACACGC

Gene: BMA3070: Predicted sugar utilization transcriptional regulator, LacI family
*
Burkholderia phymatum STM815

Site:
position = -68
score = 5.43583
sequence = CTGCGAAAACGTTTACAACA

Gene: Bphy_1500: Predicted sugar utilization transcriptional regulator, LacI family
*
Burkholderia pseudomallei K96243

Site:
position = -36
score = 6.00298
sequence = CGACGAAAACGTTTACACGC

Gene: BPSL1304: Predicted sugar utilization transcriptional regulator, LacI family
*
Burkholderia sp. 383

Site:
position = -29
score = 6.16663
sequence = GGCCGAAAACGTTTACATCG

Gene: Bcep18194_A4344: Predicted sugar utilization transcriptional regulator, LacI family
*
Burkholderia vietnamiensis G4

Site:
position = -29
score = 6.27709
sequence = CGCCGAAAACGTTTACATCG

Gene: Bcep1808_1143: Predicted sugar utilization transcriptional regulator, LacI family
*
Burkholderia xenovorans LB400

Site:
position = -33
score = 5.57126
sequence = TCACGAAAACGTTTACGAGC

Gene: Bxe_A1469: Predicted sugar utilization transcriptional regulator, LacI family
Predicted sugar utilization transcriptional regulator, LacI family
RSc1791
 
Burkholderia cepacia AMMD

Gene: Bamb_1117: Predicted sugar ABC transporter, substrate-binding protein
 
Burkholderia glumae BGR1

Gene: bglu_1g10510: Predicted sugar ABC transporter, substrate-binding protein
 
Burkholderia mallei ATCC 23344

Gene: BMA3071: Predicted sugar ABC transporter, substrate-binding protein
 
Burkholderia phymatum STM815

Gene: Bphy_1501: Predicted sugar ABC transporter, substrate-binding protein
 
Burkholderia pseudomallei K96243

Gene: BPSL1303: Predicted sugar ABC transporter, substrate-binding protein
 
Burkholderia sp. 383

Gene: Bcep18194_A4343: Predicted sugar ABC transporter, substrate-binding protein
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1142: Predicted sugar ABC transporter, substrate-binding protein
*
Burkholderia xenovorans LB400

Site:
position = -138
score = 6.36578
sequence = CGACGAAAACGTTTACATCC

Gene: Bxe_A1468: Predicted sugar ABC transporter, substrate-binding protein
Predicted sugar ABC transporter, substrate-binding protein
RSc1792
 
Burkholderia cepacia AMMD

Gene: Bamb_1116: Predicted sugar ABC transporter, permease protein 1
 
Burkholderia glumae BGR1

Gene: bglu_1g10500: Predicted sugar ABC transporter, permease protein 1
 
Burkholderia mallei ATCC 23344

Gene: BMA3072: Predicted sugar ABC transporter, permease protein 1
 
Burkholderia phymatum STM815

Gene: Bphy_1502: Predicted sugar ABC transporter, permease protein 1
 
Burkholderia pseudomallei K96243

Gene: BPSL1302: Predicted sugar ABC transporter, permease protein 1
 
Burkholderia sp. 383

Gene: Bcep18194_A4342: Predicted sugar ABC transporter, permease protein 1
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1141: Predicted sugar ABC transporter, permease protein 1
 
Burkholderia xenovorans LB400

Gene: Bxe_A1467: Predicted sugar ABC transporter, permease protein 1
Predicted sugar ABC transporter, permease protein 1
RSc1793
 
Burkholderia cepacia AMMD

Gene: Bamb_1115: Predicted sugar ABC transporter, permease protein 2
 
Burkholderia glumae BGR1

Gene: bglu_1g10490: Predicted sugar ABC transporter, permease protein 2
*
Burkholderia mallei ATCC 23344

Site:
position = -205
score = 6.47624
sequence = CGACGAAAACGTTTACATCG

Gene: BMA3075: Predicted sugar ABC transporter, permease protein 2
 
Burkholderia phymatum STM815

Gene: Bphy_1503: Predicted sugar ABC transporter, permease protein 2
*
Burkholderia pseudomallei K96243

Site:
position = -34
score = 6.47624
sequence = CGACGAAAACGTTTACATCG

Gene: BPSL1301: Predicted sugar ABC transporter, permease protein 2
 
Burkholderia sp. 383

Gene: Bcep18194_A4341: Predicted sugar ABC transporter, permease protein 2
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1140: Predicted sugar ABC transporter, permease protein 2
 
Burkholderia xenovorans LB400

Gene: Bxe_A1466: Predicted sugar ABC transporter, permease protein 2
Predicted sugar ABC transporter, permease protein 2
RSc1794
 
Burkholderia cepacia AMMD

Gene: Bamb_1114: Predicted sugar ABC transporter, ATP-binding protein
 
Burkholderia glumae BGR1

Gene: bglu_1g10480: Predicted sugar ABC transporter, ATP-binding protein
 
Burkholderia mallei ATCC 23344

Gene: BMA3076: Predicted sugar ABC transporter, ATP-binding protein
 
Burkholderia phymatum STM815

Gene: Bphy_1504: Predicted sugar ABC transporter, ATP-binding protein
 
Burkholderia pseudomallei K96243

Gene: BPSL1300: Predicted sugar ABC transporter, ATP-binding protein
 
Burkholderia sp. 383

Gene: Bcep18194_A4340: Predicted sugar ABC transporter, ATP-binding protein
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1139: Predicted sugar ABC transporter, ATP-binding protein
 
Burkholderia xenovorans LB400

Gene: Bxe_A1465: Predicted sugar ABC transporter, ATP-binding protein
Predicted sugar ABC transporter, ATP-binding protein
RSc1795
 
Burkholderia cepacia AMMD

Gene: Bamb_1113: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
 
Burkholderia glumae BGR1

Gene: bglu_1g10470: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
 
Burkholderia mallei ATCC 23344

Gene: BMA3077: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
 
Burkholderia phymatum STM815

Gene: Bphy_1505: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
 
Burkholderia pseudomallei K96243

Gene: BPSL1299: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
 
Burkholderia sp. 383

Gene: Bcep18194_A4339: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1138: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
 
Burkholderia xenovorans LB400

Gene: Bxe_A1464: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD