Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IolR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 2 2
Streptomyces coelicolor A3(2)
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces scabiei 87.22 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iolR
*
Streptomyces avermitilis MA-4680

Site:
position = -135
score = 6.20347
sequence = TCTTTGGACCGGTCCAAAAT

Site:
position = -20
score = 5.91326
sequence = GATGTGGAACGGTCCAAGAG

Gene: SAV_7156: Inositol utilization transcriptional regulator IolR, LacI family
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -102
score = 6.59248
sequence = CTTTTGGACCGTTCCAAACG

Site:
position = -20
score = 5.39801
sequence = GCTGTGGAACGGTCCAGGCC

Gene: SCAB_19101: Inositol utilization transcriptional regulator IolR, LacI family
Inositol utilization transcriptional regulator IolR, LacI family
 
CRON 2.
iolG
*
Streptomyces avermitilis MA-4680

Site:
position = -29
score = 6.20347
sequence = ATTTTGGACCGGTCCAAAGA

Site:
position = -144
score = 5.91326
sequence = CTCTTGGACCGTTCCACATC

Gene: SAV_7155: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
 
Streptomyces coelicolor A3(2)

Gene: SCO6988: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -29
score = 6.59248
sequence = CGTTTGGAACGGTCCAAAAG

Site:
position = -111
score = 5.39801
sequence = GGCCTGGACCGTTCCACAGC

Gene: SCAB_19091: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD