Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis
Ralstonia eutropha H16
Ralstonia eutropha JMP134
Ralstonia metallidurans CH34
Ralstonia pickettii 12J
Ralstonia solanacearum GMI1000 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrR
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
*
Ralstonia solanacearum GMI1000

Site:
position = 7
score = 6.2986
sequence = GCATGGTATCGATCCCACAA

Gene: RSp1286: Sucrose utilization regulator ScrR, LacI family
Sucrose utilization regulator ScrR, LacI family
 
CRON 2.
scrA
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
*
Ralstonia solanacearum GMI1000

Site:
position = -45
score = 6.72779
sequence = ATGTGGTATCGATACCATGT

Gene: RSp1285: PTS system, sucrose-specific IIBC component (EC 2.7.1.69)
PTS system, sucrose-specific IIBC component (EC 2.7.1.69)
scrB
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000

Gene: RSp1284: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrO
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000

Gene: RS05328: Predicted sucrose-specific porin
Predicted sucrose-specific porin
scrC
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000

Gene: RS05327: PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69)
PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD