Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR2 - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895
Edwardsiella tarda EIB202
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568 3 1
Yersinia pestis KIM 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
celA2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03000: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_0199: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04368: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2756: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
*
Serratia proteamaculans 568

Site:
position = -96
score = 7.74597
sequence = AAATGAGAGCGCTCTCATTT

Gene: Spro_4590: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Yersinia pestis KIM
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
bglA
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2757: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4591: 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Yersinia pestis KIM

Site:
position = -210
score = 7.74597
sequence = AAATGAGAGCGCTCTCATTT

Gene: y3950: 6-phospho-beta-glucosidase (EC 3.2.1.86)
6-phospho-beta-glucosidase (EC 3.2.1.86)
celR2
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_4592: Transcriptional regulator for cellobiose utilization, LacI family
 
Yersinia pestis KIM

Gene: y3949: Transcriptional regulator for cellobiose utilization, LacI family
Transcriptional regulator for cellobiose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD